ID: 967273459

View in Genome Browser
Species Human (GRCh38)
Location 3:187750262-187750284
Sequence CAGGTGTACAAGAGGGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967273459_967273468 16 Left 967273459 3:187750262-187750284 CCCACCGCCCTCTTGTACACCTG No data
Right 967273468 3:187750301-187750323 TCTGAAGCCAGCTCGATGGCAGG No data
967273459_967273469 17 Left 967273459 3:187750262-187750284 CCCACCGCCCTCTTGTACACCTG No data
Right 967273469 3:187750302-187750324 CTGAAGCCAGCTCGATGGCAGGG No data
967273459_967273471 25 Left 967273459 3:187750262-187750284 CCCACCGCCCTCTTGTACACCTG No data
Right 967273471 3:187750310-187750332 AGCTCGATGGCAGGGAGAGCTGG No data
967273459_967273467 12 Left 967273459 3:187750262-187750284 CCCACCGCCCTCTTGTACACCTG No data
Right 967273467 3:187750297-187750319 CCTATCTGAAGCCAGCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967273459 Original CRISPR CAGGTGTACAAGAGGGCGGT GGG (reversed) Intergenic
No off target data available for this crispr