ID: 967274332

View in Genome Browser
Species Human (GRCh38)
Location 3:187759106-187759128
Sequence CATTTGTTGCAGAGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967274332_967274340 18 Left 967274332 3:187759106-187759128 CCTTCCAACCTCTGCAACAAATG No data
Right 967274340 3:187759147-187759169 TGTCAAGGTGAATATAAGAAGGG No data
967274332_967274339 17 Left 967274332 3:187759106-187759128 CCTTCCAACCTCTGCAACAAATG No data
Right 967274339 3:187759146-187759168 ATGTCAAGGTGAATATAAGAAGG No data
967274332_967274336 3 Left 967274332 3:187759106-187759128 CCTTCCAACCTCTGCAACAAATG No data
Right 967274336 3:187759132-187759154 AGTGGATCCCATGAATGTCAAGG No data
967274332_967274341 24 Left 967274332 3:187759106-187759128 CCTTCCAACCTCTGCAACAAATG No data
Right 967274341 3:187759153-187759175 GGTGAATATAAGAAGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967274332 Original CRISPR CATTTGTTGCAGAGGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr