ID: 967279239

View in Genome Browser
Species Human (GRCh38)
Location 3:187806242-187806264
Sequence GCAGGAGGCAGGAAGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279239_967279250 20 Left 967279239 3:187806242-187806264 CCCAGCTTCTTCCTGCCTCCTGC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279239_967279247 8 Left 967279239 3:187806242-187806264 CCCAGCTTCTTCCTGCCTCCTGC No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279239_967279249 19 Left 967279239 3:187806242-187806264 CCCAGCTTCTTCCTGCCTCCTGC No data
Right 967279249 3:187806284-187806306 GTCTCCCACTGGCTGTGCCCAGG No data
967279239_967279251 21 Left 967279239 3:187806242-187806264 CCCAGCTTCTTCCTGCCTCCTGC No data
Right 967279251 3:187806286-187806308 CTCCCACTGGCTGTGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279239 Original CRISPR GCAGGAGGCAGGAAGAAGCT GGG (reversed) Intergenic