ID: 967279240

View in Genome Browser
Species Human (GRCh38)
Location 3:187806243-187806265
Sequence GGCAGGAGGCAGGAAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279240_967279249 18 Left 967279240 3:187806243-187806265 CCAGCTTCTTCCTGCCTCCTGCC No data
Right 967279249 3:187806284-187806306 GTCTCCCACTGGCTGTGCCCAGG No data
967279240_967279247 7 Left 967279240 3:187806243-187806265 CCAGCTTCTTCCTGCCTCCTGCC No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279240_967279251 20 Left 967279240 3:187806243-187806265 CCAGCTTCTTCCTGCCTCCTGCC No data
Right 967279251 3:187806286-187806308 CTCCCACTGGCTGTGCCCAGGGG No data
967279240_967279250 19 Left 967279240 3:187806243-187806265 CCAGCTTCTTCCTGCCTCCTGCC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279240 Original CRISPR GGCAGGAGGCAGGAAGAAGC TGG (reversed) Intergenic