ID: 967279241

View in Genome Browser
Species Human (GRCh38)
Location 3:187806253-187806275
Sequence GAGACAGAGGGGCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279241_967279247 -3 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279241_967279257 27 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279241_967279250 9 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279241_967279251 10 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279251 3:187806286-187806308 CTCCCACTGGCTGTGCCCAGGGG No data
967279241_967279249 8 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279249 3:187806284-187806306 GTCTCCCACTGGCTGTGCCCAGG No data
967279241_967279256 26 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279256 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279241 Original CRISPR GAGACAGAGGGGCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr