ID: 967279244

View in Genome Browser
Species Human (GRCh38)
Location 3:187806264-187806286
Sequence GACATTGTCAGGAGACAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279244_967279256 15 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279256 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data
967279244_967279259 24 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279259 3:187806311-187806333 GCCAGCTGATGTGGGTACTTGGG No data
967279244_967279250 -2 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279244_967279249 -3 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279249 3:187806284-187806306 GTCTCCCACTGGCTGTGCCCAGG No data
967279244_967279251 -1 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279251 3:187806286-187806308 CTCCCACTGGCTGTGCCCAGGGG No data
967279244_967279258 23 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279258 3:187806310-187806332 AGCCAGCTGATGTGGGTACTTGG No data
967279244_967279257 16 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279244 Original CRISPR GACATTGTCAGGAGACAGAG GGG (reversed) Intergenic
No off target data available for this crispr