ID: 967279247

View in Genome Browser
Species Human (GRCh38)
Location 3:187806273-187806295
Sequence CTCCTGACAATGTCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279239_967279247 8 Left 967279239 3:187806242-187806264 CCCAGCTTCTTCCTGCCTCCTGC No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279241_967279247 -3 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279243_967279247 -10 Left 967279243 3:187806260-187806282 CCTGCCCCTCTGTCTCCTGACAA No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279240_967279247 7 Left 967279240 3:187806243-187806265 CCAGCTTCTTCCTGCCTCCTGCC No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data
967279242_967279247 -7 Left 967279242 3:187806257-187806279 CCTCCTGCCCCTCTGTCTCCTGA No data
Right 967279247 3:187806273-187806295 CTCCTGACAATGTCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279247 Original CRISPR CTCCTGACAATGTCTCCCAC TGG Intergenic
No off target data available for this crispr