ID: 967279248

View in Genome Browser
Species Human (GRCh38)
Location 3:187806275-187806297
Sequence AGCCAGTGGGAGACATTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279248_967279258 12 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279258 3:187806310-187806332 AGCCAGCTGATGTGGGTACTTGG No data
967279248_967279257 5 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279248_967279256 4 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279256 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data
967279248_967279259 13 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279259 3:187806311-187806333 GCCAGCTGATGTGGGTACTTGGG No data
967279248_967279262 24 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279248_967279261 23 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279261 3:187806321-187806343 GTGGGTACTTGGGATACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279248 Original CRISPR AGCCAGTGGGAGACATTGTC AGG (reversed) Intergenic
No off target data available for this crispr