ID: 967279250

View in Genome Browser
Species Human (GRCh38)
Location 3:187806285-187806307
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279242_967279250 5 Left 967279242 3:187806257-187806279 CCTCCTGCCCCTCTGTCTCCTGA No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279239_967279250 20 Left 967279239 3:187806242-187806264 CCCAGCTTCTTCCTGCCTCCTGC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279245_967279250 -3 Left 967279245 3:187806265-187806287 CCCTCTGTCTCCTGACAATGTCT No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279243_967279250 2 Left 967279243 3:187806260-187806282 CCTGCCCCTCTGTCTCCTGACAA No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279240_967279250 19 Left 967279240 3:187806243-187806265 CCAGCTTCTTCCTGCCTCCTGCC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279246_967279250 -4 Left 967279246 3:187806266-187806288 CCTCTGTCTCCTGACAATGTCTC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279241_967279250 9 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data
967279244_967279250 -2 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279250 3:187806285-187806307 TCTCCCACTGGCTGTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr