ID: 967279252

View in Genome Browser
Species Human (GRCh38)
Location 3:187806288-187806310
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279252_967279262 11 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279252_967279258 -1 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279258 3:187806310-187806332 AGCCAGCTGATGTGGGTACTTGG No data
967279252_967279259 0 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279259 3:187806311-187806333 GCCAGCTGATGTGGGTACTTGGG No data
967279252_967279257 -8 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279252_967279261 10 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279261 3:187806321-187806343 GTGGGTACTTGGGATACACAAGG No data
967279252_967279263 25 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279252_967279256 -9 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279256 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279252 Original CRISPR TTCCCCTGGGCACAGCCAGT GGG (reversed) Intergenic