ID: 967279253

View in Genome Browser
Species Human (GRCh38)
Location 3:187806289-187806311
Sequence CTTCCCCTGGGCACAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279253_967279262 10 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279253_967279263 24 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279253_967279258 -2 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279258 3:187806310-187806332 AGCCAGCTGATGTGGGTACTTGG No data
967279253_967279264 30 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279264 3:187806342-187806364 GGGTCATCCCTCTGTGGTTGAGG No data
967279253_967279259 -1 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279259 3:187806311-187806333 GCCAGCTGATGTGGGTACTTGGG No data
967279253_967279256 -10 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279256 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data
967279253_967279257 -9 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279253_967279261 9 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279261 3:187806321-187806343 GTGGGTACTTGGGATACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279253 Original CRISPR CTTCCCCTGGGCACAGCCAG TGG (reversed) Intergenic
No off target data available for this crispr