ID: 967279254

View in Genome Browser
Species Human (GRCh38)
Location 3:187806301-187806323
Sequence CACATCAGCTGGCTTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279254_967279265 19 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279265 3:187806343-187806365 GGTCATCCCTCTGTGGTTGAGGG No data
967279254_967279261 -3 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279261 3:187806321-187806343 GTGGGTACTTGGGATACACAAGG No data
967279254_967279264 18 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279264 3:187806342-187806364 GGGTCATCCCTCTGTGGTTGAGG No data
967279254_967279262 -2 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279254_967279263 12 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279254 Original CRISPR CACATCAGCTGGCTTCCCCT GGG (reversed) Intergenic