ID: 967279257

View in Genome Browser
Species Human (GRCh38)
Location 3:187806303-187806325
Sequence CAGGGGAAGCCAGCTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279245_967279257 15 Left 967279245 3:187806265-187806287 CCCTCTGTCTCCTGACAATGTCT No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279252_967279257 -8 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279253_967279257 -9 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279243_967279257 20 Left 967279243 3:187806260-187806282 CCTGCCCCTCTGTCTCCTGACAA No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279241_967279257 27 Left 967279241 3:187806253-187806275 CCTGCCTCCTGCCCCTCTGTCTC No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279244_967279257 16 Left 967279244 3:187806264-187806286 CCCCTCTGTCTCCTGACAATGTC No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279248_967279257 5 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279242_967279257 23 Left 967279242 3:187806257-187806279 CCTCCTGCCCCTCTGTCTCCTGA No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data
967279246_967279257 14 Left 967279246 3:187806266-187806288 CCTCTGTCTCCTGACAATGTCTC No data
Right 967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279257 Original CRISPR CAGGGGAAGCCAGCTGATGT GGG Intergenic
No off target data available for this crispr