ID: 967279260

View in Genome Browser
Species Human (GRCh38)
Location 3:187806312-187806334
Sequence TCCCAAGTACCCACATCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279260_967279264 7 Left 967279260 3:187806312-187806334 CCAGCTGATGTGGGTACTTGGGA No data
Right 967279264 3:187806342-187806364 GGGTCATCCCTCTGTGGTTGAGG No data
967279260_967279263 1 Left 967279260 3:187806312-187806334 CCAGCTGATGTGGGTACTTGGGA No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279260_967279268 23 Left 967279260 3:187806312-187806334 CCAGCTGATGTGGGTACTTGGGA No data
Right 967279268 3:187806358-187806380 GTTGAGGGAAGAGCAATGAATGG No data
967279260_967279265 8 Left 967279260 3:187806312-187806334 CCAGCTGATGTGGGTACTTGGGA No data
Right 967279265 3:187806343-187806365 GGTCATCCCTCTGTGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279260 Original CRISPR TCCCAAGTACCCACATCAGC TGG (reversed) Intergenic