ID: 967279262

View in Genome Browser
Species Human (GRCh38)
Location 3:187806322-187806344
Sequence TGGGTACTTGGGATACACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279254_967279262 -2 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279252_967279262 11 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279253_967279262 10 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279248_967279262 24 Left 967279248 3:187806275-187806297 CCTGACAATGTCTCCCACTGGCT No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data
967279255_967279262 -3 Left 967279255 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data
Right 967279262 3:187806322-187806344 TGGGTACTTGGGATACACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279262 Original CRISPR TGGGTACTTGGGATACACAA GGG Intergenic
No off target data available for this crispr