ID: 967279263

View in Genome Browser
Species Human (GRCh38)
Location 3:187806336-187806358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279260_967279263 1 Left 967279260 3:187806312-187806334 CCAGCTGATGTGGGTACTTGGGA No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279253_967279263 24 Left 967279253 3:187806289-187806311 CCACTGGCTGTGCCCAGGGGAAG No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279254_967279263 12 Left 967279254 3:187806301-187806323 CCCAGGGGAAGCCAGCTGATGTG No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279252_967279263 25 Left 967279252 3:187806288-187806310 CCCACTGGCTGTGCCCAGGGGAA No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data
967279255_967279263 11 Left 967279255 3:187806302-187806324 CCAGGGGAAGCCAGCTGATGTGG No data
Right 967279263 3:187806336-187806358 ACACAAGGGTCATCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type