ID: 967279708

View in Genome Browser
Species Human (GRCh38)
Location 3:187810069-187810091
Sequence CCCAGGGAATAGCAGTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967279694_967279708 26 Left 967279694 3:187810020-187810042 CCATGCACACTCCAGCATGGTCC No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279697_967279708 5 Left 967279697 3:187810041-187810063 CCCTCCTCCTACCAGGTGATGAC No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279699_967279708 1 Left 967279699 3:187810045-187810067 CCTCCTACCAGGTGATGACAAGG No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279691_967279708 30 Left 967279691 3:187810016-187810038 CCTCCCATGCACACTCCAGCATG No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279702_967279708 -6 Left 967279702 3:187810052-187810074 CCAGGTGATGACAAGGCCCCAGG No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279701_967279708 -2 Left 967279701 3:187810048-187810070 CCTACCAGGTGATGACAAGGCCC No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279695_967279708 15 Left 967279695 3:187810031-187810053 CCAGCATGGTCCCTCCTCCTACC No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279698_967279708 4 Left 967279698 3:187810042-187810064 CCTCCTCCTACCAGGTGATGACA No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data
967279693_967279708 27 Left 967279693 3:187810019-187810041 CCCATGCACACTCCAGCATGGTC No data
Right 967279708 3:187810069-187810091 CCCAGGGAATAGCAGTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967279708 Original CRISPR CCCAGGGAATAGCAGTACTT GGG Intergenic
No off target data available for this crispr