ID: 967282304

View in Genome Browser
Species Human (GRCh38)
Location 3:187834042-187834064
Sequence CCCTGTGTGAAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967282291_967282304 29 Left 967282291 3:187833990-187834012 CCAGCAGACTCTGCTGTGTATCC No data
Right 967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG No data
967282297_967282304 0 Left 967282297 3:187834019-187834041 CCTGGCACTGAAGCCCCAGATAG No data
Right 967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG No data
967282290_967282304 30 Left 967282290 3:187833989-187834011 CCCAGCAGACTCTGCTGTGTATC No data
Right 967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG No data
967282296_967282304 8 Left 967282296 3:187834011-187834033 CCAGGGGACCTGGCACTGAAGCC No data
Right 967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967282304 Original CRISPR CCCTGTGTGAAGAAGGTGGC TGG Intergenic
No off target data available for this crispr