ID: 967290311

View in Genome Browser
Species Human (GRCh38)
Location 3:187913379-187913401
Sequence CATGGAGGCTTATAAGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967290302_967290311 25 Left 967290302 3:187913331-187913353 CCTTAACAAACAAAACAGGGATT No data
Right 967290311 3:187913379-187913401 CATGGAGGCTTATAAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967290311 Original CRISPR CATGGAGGCTTATAAGCAAG TGG Intergenic
No off target data available for this crispr