ID: 967294799

View in Genome Browser
Species Human (GRCh38)
Location 3:187954537-187954559
Sequence ACACCCTACTTCCCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967294794_967294799 26 Left 967294794 3:187954488-187954510 CCAGAGGAACCAGCTGGTCGAGC No data
Right 967294799 3:187954537-187954559 ACACCCTACTTCCCAAAGCCTGG No data
967294795_967294799 17 Left 967294795 3:187954497-187954519 CCAGCTGGTCGAGCTTTGTGAAC No data
Right 967294799 3:187954537-187954559 ACACCCTACTTCCCAAAGCCTGG No data
967294793_967294799 29 Left 967294793 3:187954485-187954507 CCACCAGAGGAACCAGCTGGTCG No data
Right 967294799 3:187954537-187954559 ACACCCTACTTCCCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967294799 Original CRISPR ACACCCTACTTCCCAAAGCC TGG Intergenic
No off target data available for this crispr