ID: 967295356

View in Genome Browser
Species Human (GRCh38)
Location 3:187958897-187958919
Sequence CTGTGGCCTTTGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967295345_967295356 22 Left 967295345 3:187958852-187958874 CCTCCGAGTGTGCTGCTCAGAGC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 313
967295346_967295356 19 Left 967295346 3:187958855-187958877 CCGAGTGTGCTGCTCAGAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 276
Right 967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 313
967295352_967295356 -4 Left 967295352 3:187958878-187958900 CCGGGTGATTCTCATGGGCCTGT 0: 1
1: 1
2: 1
3: 21
4: 235
Right 967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967295356 Original CRISPR CTGTGGCCTTTGATGGAGCC AGG Intergenic
900122822 1:1056205-1056227 GGGTGGCCCTGGATGGAGCCAGG + Intergenic
900148505 1:1168347-1168369 CTATGGCCTTTCCTGGAGCCAGG - Intergenic
900170033 1:1262723-1262745 CTGGGGCCTTTGGCGGAGGCTGG - Intronic
900313994 1:2048148-2048170 CTGTGGCCTTGTCTGGAGTCTGG - Intergenic
900415332 1:2532072-2532094 CTCTGGCCCTTGATGGATGCAGG + Intergenic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
901666669 1:10830178-10830200 CTTTGGCCTTTGATCACGCCCGG - Intergenic
901801165 1:11708856-11708878 CAGTGGCCTTTGAGGAAGCTGGG - Intronic
903735872 1:25529761-25529783 CTGAGGCCCATGGTGGAGCCAGG - Intergenic
903785529 1:25858944-25858966 CTGTGGCCTCCTAGGGAGCCTGG + Intronic
904277382 1:29393342-29393364 CCCTGGCCTTTGATGGGGACAGG + Intergenic
904697790 1:32339969-32339991 CAGAGGCCTTTGCTGGAGCAAGG + Intergenic
905296201 1:36956018-36956040 CTCTGGCTGTTGGTGGAGCCTGG - Intronic
905635381 1:39547814-39547836 CTGTCCCTTTTGATGGAGGCTGG + Intergenic
906442179 1:45857754-45857776 CTGGGGCCTGTCATGGAGTCGGG - Intronic
906694475 1:47814783-47814805 CTGTCTCCTTTGATGCACCCTGG - Intronic
907456473 1:54579634-54579656 ATGGGGCCTTTCATGGGGCCTGG + Intronic
908389516 1:63672070-63672092 CAGTGGGCTATGATGGTGCCTGG - Intergenic
910522245 1:88135968-88135990 CTCTGGCCTTTGATTGATCATGG - Intergenic
912223822 1:107708575-107708597 TTAAGGCCTGTGATGGAGCCAGG - Intronic
912254694 1:108046981-108047003 CTGTGGCATTGGTTGGAGCCTGG - Intergenic
912732864 1:112125133-112125155 CTGTGGCATTTCAAGGACCCTGG + Intergenic
913200748 1:116493826-116493848 CTGAGGCCTGAGATGGTGCCGGG + Intergenic
913252958 1:116927356-116927378 TTGTGGCCTTTGAGAGATCCTGG - Intronic
913790382 1:122515273-122515295 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913800952 1:122704994-122705016 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913801356 1:122712469-122712491 TTGTGGCCTTCGATGGAAACGGG + Intergenic
913803045 1:122742724-122742746 TTGTGGCCTTCGCTGGAACCGGG + Intergenic
913809848 1:122865468-122865490 TTGTGGCCTTCGATGGAAACGGG + Intergenic
913817023 1:122993634-122993656 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913824438 1:123126680-123126702 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913826640 1:123165779-123165801 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913835591 1:123326188-123326210 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913848281 1:123554057-123554079 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913850338 1:123591097-123591119 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913850456 1:123593136-123593158 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913855509 1:123683904-123683926 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913864324 1:123841781-123841803 TTGTGGCCTTCGATGGAAACGGG + Intergenic
913871096 1:123963276-123963298 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913871341 1:123967692-123967714 TTGTGGCCTTCGATGGAAACGGG + Intergenic
913873658 1:124009835-124009857 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913876457 1:124059814-124059836 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913877094 1:124071028-124071050 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913879020 1:124105011-124105033 TTGTGGCCTTTGTTGGAAACAGG + Intergenic
913886909 1:124246648-124246670 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913898116 1:124447209-124447231 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913899723 1:124475761-124475783 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
913899840 1:124477800-124477822 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
913905235 1:124575330-124575352 TTGTGGCCTTCGATGGAAACGGG + Intergenic
913911197 1:124682068-124682090 TTGTGGCCTTCGATGGAAACGGG + Intergenic
914747609 1:150511384-150511406 CAGTGTCCTTTCCTGGAGCCTGG + Intronic
916461070 1:165025017-165025039 CTGAGGAATTTGAGGGAGCCAGG + Intergenic
918372906 1:183879687-183879709 CTGTGGCATGTGATTGAGTCAGG + Intronic
919933034 1:202234064-202234086 CTCTGGCATTGGGTGGAGCCTGG + Intronic
923211717 1:231809296-231809318 CTCTGGCCAGTGAGGGAGCCTGG + Intronic
1062769980 10:91722-91744 CTGTGGCCCTTCAGGGTGCCCGG - Intergenic
1064270402 10:13860045-13860067 TTGTAGCATTTGCTGGAGCCTGG + Intronic
1065012575 10:21432794-21432816 CTAGGGCCTCTGATGGTGCCTGG - Intergenic
1065069313 10:22005368-22005390 CTGTGGTCTTTGCAGGAACCTGG - Intergenic
1065742316 10:28808155-28808177 CTGTGTCCTTTGCCGGAGCCTGG + Intergenic
1065835517 10:29654722-29654744 CTTTGGACTTAGATGGAGACAGG - Intronic
1066925910 10:41589400-41589422 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1067308605 10:45091461-45091483 CAGTGGGCTCTGCTGGAGCCGGG - Intergenic
1067700705 10:48569319-48569341 CTGTGGCCTTTGCTAAAGACAGG - Intronic
1070723380 10:78772091-78772113 CTGCTGCCTGTGATGGGGCCTGG + Intergenic
1076034487 10:127187659-127187681 GTGTGGCCTTCGAGGGAGCGAGG - Intronic
1076215851 10:128692981-128693003 GAGTGGGCTTTGAAGGAGCCAGG - Intergenic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076464285 10:130667553-130667575 CTGTGGCCTCTGCTTGAGACAGG + Intergenic
1077327708 11:1970898-1970920 CTGCGGCACCTGATGGAGCCTGG + Intronic
1077393871 11:2311818-2311840 CTGGGGGCTCTGAAGGAGCCTGG - Intronic
1078424681 11:11239344-11239366 CTGTGGCTTGTGATAGACCCAGG - Intergenic
1078584159 11:12566504-12566526 ATGAGTCCTTTGATGGAGCTGGG - Intergenic
1079898210 11:26148934-26148956 CTGGGGCCTTGGAGGCAGCCAGG + Intergenic
1081672360 11:44949461-44949483 CTCTGGGCTTTGGAGGAGCCTGG + Intronic
1082163853 11:48918407-48918429 TTGAGGCCTTTGATGGAAACAGG - Intergenic
1083698511 11:64458311-64458333 CAGAGCCCATTGATGGAGCCTGG + Intergenic
1084125538 11:67096664-67096686 CTTTGGCTTTGGGTGGAGCCAGG + Intergenic
1084682211 11:70673046-70673068 ATGTGGTCTTTGATGCAGGCTGG + Intronic
1084806290 11:71581512-71581534 CTGGGGCCTTGGAAGGACCCAGG - Intronic
1084910160 11:72381712-72381734 CTGTGGGCTGGGCTGGAGCCTGG - Intronic
1085399311 11:76226044-76226066 CTGTGGCCGTGCATGGGGCCTGG - Intergenic
1089140015 11:116277122-116277144 CTGTGGCCGGTGGTGGGGCCAGG - Intergenic
1090365057 11:126198559-126198581 CTGGGGCCCTTCAAGGAGCCTGG + Intergenic
1202810690 11_KI270721v1_random:26078-26100 CTGCGGCACCTGATGGAGCCTGG + Intergenic
1093961386 12:25276575-25276597 CAATGGCCTATGATGAAGCCTGG - Intergenic
1094109824 12:26849825-26849847 CAGTGGGCTTTGATGGGACCAGG + Intergenic
1094607741 12:31963375-31963397 CTTTGGGTTTTGATGGATCCAGG + Intronic
1095057931 12:37639484-37639506 CTGTGGCCTTTGTTGGAAACGGG - Intergenic
1098345124 12:69494615-69494637 CTCTGGCCTTAGGTAGAGCCAGG - Intronic
1099802520 12:87474653-87474675 CTGTGGCTTTTCCTGGAGCACGG - Intergenic
1101129594 12:101675102-101675124 CTGTGCCCTTTGATCTGGCCTGG + Intronic
1102542476 12:113632293-113632315 ACCTGGCCTGTGATGGAGCCAGG - Intergenic
1102684988 12:114717689-114717711 CTGTGGAATTTGTGGGAGCCAGG + Intergenic
1104046960 12:125170108-125170130 CTGAGCCCTTTCATGGGGCCTGG + Intergenic
1104072891 12:125361803-125361825 CTGTGAGCTCTGATGGAGGCTGG + Intronic
1104728702 12:131093496-131093518 CTGTGCCCTTCCCTGGAGCCAGG - Intronic
1106293741 13:28390964-28390986 CTGTGGTCTTTGCTGGACCAGGG - Intronic
1108028928 13:46207971-46207993 CTGTCACCATTGATTGAGCCGGG - Intronic
1108787384 13:53921288-53921310 CTGTGGCCCTTTGGGGAGCCAGG - Intergenic
1111800588 13:92975215-92975237 CTGTGCTCTTTGTGGGAGCCAGG - Intergenic
1112409131 13:99146930-99146952 CTGTGGCCTTATTTGGAACCAGG - Intergenic
1113761024 13:112846715-112846737 CTGTGGGCTTTGTTGGATGCTGG + Intronic
1113952577 13:114080131-114080153 CGCTGGGCTTGGATGGAGCCAGG + Intronic
1114411300 14:22502984-22503006 CTGTGGCTTTGGCTGGGGCCAGG + Intergenic
1115227864 14:31123545-31123567 CTCTTGCCTTCGATGGAGACTGG + Intronic
1115645518 14:35366387-35366409 CTGTGGCCCATGATGGAGTCAGG + Intergenic
1117426346 14:55601984-55602006 CTGTGGCCTCTGAAGGTGCTGGG + Intronic
1117580689 14:57148708-57148730 CTATGGCCTTTCAGGGTGCCTGG - Intergenic
1119141932 14:72275036-72275058 TTGTGGCATTTGTTGGAACCAGG - Intronic
1121005199 14:90486099-90486121 CTGTGTACCTTGCTGGAGCCGGG - Intergenic
1121020219 14:90575435-90575457 CTGTGCCCTTCGATGGAGGAAGG - Intronic
1121103521 14:91265368-91265390 CTGAGGCCTTTCATGGGGCTGGG + Intergenic
1122274845 14:100586271-100586293 CTGGGGCCTCCGACGGAGCCTGG + Intronic
1122811627 14:104292174-104292196 CTATGGCCTTTGATAGAACCCGG + Intergenic
1123385365 15:19792512-19792534 TTGTGGCCTTTGTTGGAAACGGG - Intergenic
1124456748 15:29850107-29850129 CTCTAGCCTTGGATGGACCCTGG + Intronic
1125796816 15:42409480-42409502 CTTTGGACTTTGGTGGAGCCAGG + Intronic
1126464832 15:48952124-48952146 CAATGGCCTTTCAAGGAGCCAGG + Intronic
1127282723 15:57505506-57505528 CTCTGGGCTTTGTAGGAGCCTGG + Intronic
1128084053 15:64873836-64873858 CTGTGGCCCAGGCTGGAGCCAGG + Intronic
1128549026 15:68585770-68585792 CTGTGGTCTTTACTGGAGCTAGG + Intronic
1129875755 15:78974191-78974213 ATGGAGCCTGTGATGGAGCCCGG + Intronic
1129920145 15:79312603-79312625 CCGTGTCCTTTGATGGATCTTGG + Intronic
1132859092 16:2061280-2061302 CTGTGCCTTTTCCTGGAGCCTGG + Intronic
1134852110 16:17488316-17488338 CTTTGGACTTGAATGGAGCCAGG - Intergenic
1135247166 16:20866920-20866942 CTGGGCACTGTGATGGAGCCTGG - Intronic
1137668383 16:50265341-50265363 CTGTGGCCTCTGGAGCAGCCTGG + Intronic
1140571916 16:76117742-76117764 CTGTAGGCTTTAATGAAGCCTGG + Intergenic
1141489265 16:84360896-84360918 GTGTGGCCTATGAAGGAGTCTGG + Intergenic
1141991388 16:87612566-87612588 CAGTGGTCTTGGATGGACCCCGG - Intronic
1142852754 17:2712017-2712039 CTGTGACCTTGGGTGGAGACTGG + Exonic
1144867616 17:18347010-18347032 CTGTGGCTGTGGATGGTGCCGGG + Intronic
1145472915 17:23565689-23565711 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145484068 17:23727531-23727553 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145491693 17:23838483-23838505 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145543589 17:24593904-24593926 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145588138 17:25241404-25241426 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145627459 17:25814557-25814579 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145646569 17:26091888-26091910 CTGTGGCCTTTGTTCGAAACGGG + Intergenic
1145680458 17:26584256-26584278 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145681547 17:26599782-26599804 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145681711 17:26602164-26602186 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145682040 17:26606927-26606949 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145682148 17:26608460-26608482 CTGTGGCCTTCGATCGAAACGGG + Intergenic
1145682379 17:26611692-26611714 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145682853 17:26618609-26618631 CTGTGGCCTTCGATCGAAACGGG + Intergenic
1145683088 17:26621837-26621859 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145683257 17:26624212-26624234 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145683420 17:26626593-26626615 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145683670 17:26630648-26630670 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1145733174 17:27209052-27209074 CTGTGGCCTGTCATGGGGTCGGG + Intergenic
1145816591 17:27799192-27799214 CTGTGGCCAGTGATGAAGCCTGG - Intronic
1145959473 17:28879108-28879130 CTTCTGCCTGTGATGGAGCCAGG + Intergenic
1147879027 17:43642156-43642178 CTGGGGCCTTTGAGGGAGTAGGG - Intronic
1149256761 17:54836275-54836297 CCATGGCCTGTGCTGGAGCCTGG - Intergenic
1149998011 17:61415050-61415072 CTGTGTCCTTTCCTGGAGCCTGG + Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1152666587 17:81573815-81573837 ATGTAGCCTTTGATGGGGCGGGG - Intronic
1153260061 18:3215225-3215247 CTGTGCCCCTTGAAGGAACCGGG + Exonic
1157476679 18:48028364-48028386 CTGTGGGCTTTGCTGAAGCTCGG + Exonic
1157523141 18:48359119-48359141 CTGTGCCCTTTGTTGGGGGCTGG - Intronic
1158625657 18:59069605-59069627 ATGTGGCCTTATTTGGAGCCAGG + Intergenic
1160183866 18:76659813-76659835 CTGTGGCCTGTATTGCAGCCTGG + Intergenic
1160881678 19:1323606-1323628 CAGTGTCCATTGATGGATCCGGG - Intergenic
1161043851 19:2124045-2124067 CTCAGGCCTGTGATGGAGCTAGG - Intronic
1161057700 19:2198867-2198889 ATGTGGCCTGGGTTGGAGCCTGG + Intronic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1161522256 19:4731131-4731153 CTGTGCCCTCTGGTGGACCCAGG + Intergenic
1161654853 19:5507897-5507919 CAGTTGCCTCTGCTGGAGCCAGG - Intergenic
1161723923 19:5917800-5917822 CGGTGGCCCCTGAAGGAGCCAGG + Exonic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1162695340 19:12469392-12469414 CTGTCCCATTTGATGGAGGCAGG + Intronic
1162768374 19:12933886-12933908 CAGACGCCATTGATGGAGCCAGG - Intronic
1164737625 19:30553513-30553535 CTGTGTCCTTTGGTGGACCCAGG + Intronic
1166270742 19:41711943-41711965 CATTGGCTTGTGATGGAGCCTGG - Intronic
1168217027 19:54933927-54933949 CTGTGTCCTGTGATGGCTCCAGG - Intronic
1168695070 19:58399649-58399671 CTGCTGGCTTTGAAGGAGCCAGG - Intergenic
925091046 2:1156271-1156293 CTGTGGCCTTAGATAGATCGAGG + Intronic
925317188 2:2935581-2935603 CAGAGGCCTTGGATGGGGCCAGG - Intergenic
925630719 2:5890278-5890300 CTGGGGCCTGTCATGGAGTCAGG - Intergenic
927444079 2:23142328-23142350 CTCTGGCCTTTGCTGGATACAGG - Intergenic
931073522 2:58683165-58683187 CTGTGGCCTTTGCTGCAACATGG - Intergenic
931834608 2:66085583-66085605 CTGCGGGCTTTGAGGGAGCTGGG + Intergenic
932773310 2:74513586-74513608 CTGAGGCCTTGGTTGGATCCTGG - Intronic
933392434 2:81688315-81688337 CTGTGGCTTTTGTTGGTTCCAGG + Intergenic
934157808 2:89219435-89219457 CTGTGGCTTCTGCTGGTGCCAGG + Intergenic
934165385 2:89289637-89289659 CTGGAGCCTCTGAAGGAGCCTGG - Intergenic
934201889 2:89892825-89892847 CTGGAGCCTCTGAAGGAGCCTGG + Intergenic
934209455 2:89962991-89963013 CTGTGGCTTCTGCTGGTGCCAGG - Intergenic
935658802 2:105447960-105447982 ATGTGGACTGTGTTGGAGCCTGG + Intergenic
936895731 2:117425417-117425439 ATGTGGCCTTGTTTGGAGCCAGG + Intergenic
937011985 2:118571223-118571245 CAGTGGCCTGTGATGGGGTCTGG + Intergenic
937534999 2:122875338-122875360 CTCTGGGCTTTCTTGGAGCCTGG - Intergenic
938061894 2:128261312-128261334 CTGTGGCCTCTGCTGGGACCGGG + Intronic
939896148 2:147793446-147793468 CTGTGGTCTTTGATGGATTGTGG - Intergenic
942277380 2:174333184-174333206 CTCGGCCCTGTGATGGAGCCTGG - Intergenic
944539380 2:200741605-200741627 CTACTGCCTTTGCTGGAGCCAGG - Intergenic
944539621 2:200743212-200743234 CTATTGCCTTGGCTGGAGCCGGG - Intergenic
945258732 2:207824726-207824748 GTGTGTCCTCTGACGGAGCCTGG - Intergenic
946936129 2:224722507-224722529 TTGTGGTCTTTGTTTGAGCCGGG - Intergenic
947637384 2:231686926-231686948 CTGTGGGATGTGATGGAGCCAGG - Intergenic
948330662 2:237161760-237161782 CTGAGGGCTGTCATGGAGCCTGG - Intergenic
1168764423 20:372088-372110 CTCTGGCCTTTGATGGCTTCAGG + Intronic
1169081971 20:2802919-2802941 CTGTTGCCTTTGATTTAACCTGG + Intergenic
1171122087 20:22576944-22576966 CTCGGGCCTTTGATGGCCCCGGG - Intergenic
1171286085 20:23938939-23938961 CTGTGGCCATTCTGGGAGCCAGG + Intergenic
1171574665 20:26294878-26294900 TTGAGGCCTTTGATGGAAACGGG + Intergenic
1171808623 20:29718313-29718335 TTGAGGCCTTTGATGGAAACGGG - Intergenic
1172603896 20:36201724-36201746 CTGTGGCCCTTCATGGATGCTGG + Intronic
1172853433 20:37983162-37983184 GTGTGGCCTGTGAGGGAGCTGGG + Exonic
1172949734 20:38715224-38715246 CAGTGGCATTTGAAGGAGACAGG + Intergenic
1173486923 20:43447908-43447930 CTGCGGCCTTTGGTGGTGGCTGG - Intergenic
1174289829 20:49500195-49500217 CTGTGGCCTTGGAGGCAGTCAGG - Intergenic
1177566611 21:22831123-22831145 CTGAGGCCTTTGCTGGAGTATGG - Intergenic
1179146725 21:38774721-38774743 ATGGGGCCTGGGATGGAGCCTGG - Intergenic
1179522009 21:41951918-41951940 CTGTGTCCTTTGTAGGAGGCAGG - Intronic
1180505498 22:15995042-15995064 TTGTGGCCTTTGTTGGAAACGGG - Intergenic
1181138152 22:20783957-20783979 CTGTGGCCTTTACAGGATCCTGG + Exonic
1182749575 22:32630806-32630828 CTGTAGCCTGTGAAGGGGCCAGG - Intronic
1185076802 22:48687517-48687539 CTGTGAGCCTTGATGGATCCAGG + Intronic
1203333161 22_KI270739v1_random:27005-27027 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
950475119 3:13210176-13210198 AAGTGGCATTTGATGAAGCCAGG - Intergenic
953697800 3:45173279-45173301 ATGTGGCCAGTGATGGAGGCTGG + Intergenic
954139033 3:48595524-48595546 CTGTGACCTTAGATGGAGTTAGG - Intergenic
954610949 3:51944249-51944271 CTGTGGCCTTTTGAGGACCCTGG - Intronic
957922203 3:86760184-86760206 CCGTGGCCCATGCTGGAGCCTGG + Intergenic
958206869 3:90411161-90411183 TTGAGGCCTTTGATGGAAACAGG - Intergenic
958208693 3:90438393-90438415 TTGAGGCCTTTGATGGATACAGG - Intergenic
958211588 3:90486909-90486931 TTGAGGCCTTTGTTGGAACCGGG - Intergenic
958288352 3:91784727-91784749 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
958316212 3:92240394-92240416 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
958330146 3:92469592-92469614 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
958402281 3:93650759-93650781 TTGTGGCCTTTGTTGGAAACGGG + Intergenic
958707274 3:97671685-97671707 CTGTGGCCTTGGATAGACTCAGG + Intronic
960385562 3:117018195-117018217 CTGTTGCCTGTGATGGAGATTGG - Intronic
961810364 3:129518534-129518556 CTGTGGCACCTGAGGGAGCCTGG - Intronic
961990376 3:131183439-131183461 CTGGGGCCTGTCATGGGGCCAGG - Intronic
963783447 3:149509831-149509853 GTGTGGCCTTTCCTGGAGCAGGG + Intergenic
963860775 3:150308146-150308168 CTGTGGCAGTTGGTGGAGGCAGG + Intergenic
964970332 3:162552449-162552471 CTGTGTTCTTTGATGGAGAGAGG - Intergenic
967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG + Intergenic
967890541 3:194361385-194361407 CCGTGGCCAATGATGGAGACTGG - Intronic
968602824 4:1518404-1518426 CTGTGGCCAGTGAAGGAGGCCGG + Intergenic
968927891 4:3559546-3559568 CTGTGGCCTTTGTTGTGGACAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969351982 4:6603379-6603401 CTGTGTCCTGGGATGGGGCCTGG - Intronic
969515442 4:7645550-7645572 CTGTGGCCTTTTACGGAGCCAGG - Intronic
970140584 4:12977715-12977737 CTGAGTCCTTTGATTCAGCCAGG + Intergenic
971066688 4:23040811-23040833 CAGTGTCCTTTGATGAAGCCAGG - Intergenic
971386073 4:26141412-26141434 CTGGGGCCTGTGCTGCAGCCTGG - Intergenic
972880529 4:43417201-43417223 CTGTGGCTTTTCCAGGAGCCTGG + Intergenic
973969989 4:56203885-56203907 CAGTGGCCTTGTATGGAGGCAGG - Intronic
974347604 4:60701780-60701802 CTGTGGCCTTTCATGGGGTGTGG + Intergenic
975261228 4:72302007-72302029 GTGTGGCCTTTCATGGTGCCAGG - Intronic
975266716 4:72377717-72377739 AAGTGGCCTTTGATGTTGCCAGG + Intronic
975597204 4:76060073-76060095 CTGTTGCCTTGCATGGAGTCAGG + Intronic
978617202 4:110609916-110609938 CAGTGGCCTTTGAAGAAGCTAGG + Intergenic
978746682 4:112202530-112202552 CTGTGGCCTTTAGAGGACCCTGG + Intergenic
979860210 4:125683678-125683700 CTGTGGACTTTGCTGGATTCTGG + Intergenic
981392144 4:144203496-144203518 CTTTGGCCTATGATGTAGCTGGG + Intergenic
982291877 4:153789578-153789600 GTGTGCCCTGTGATGGAGCCCGG + Intergenic
982451014 4:155552385-155552407 CTGTGGGCTGTGAGGAAGCCGGG + Intergenic
986308783 5:6535940-6535962 CAGGGGCCTTGGATGGAGGCAGG - Intergenic
989858963 5:46341234-46341256 TTGTGGCCTTTGTTGGAAACGGG - Intergenic
990598565 5:57334706-57334728 CTGTGGCCTTTGGTAGAGGAAGG - Intergenic
991188687 5:63842516-63842538 TTGAGCCCTTTGATGGAGCTGGG + Intergenic
992147467 5:73865714-73865736 CTGAGGCTTTTAATGAAGCCAGG + Intronic
992376055 5:76188845-76188867 CTATGGACTCTGATGGAGTCTGG + Intronic
994198196 5:96942711-96942733 CTGGGGCCTGTCATGGAGTCGGG + Intronic
996409279 5:123139648-123139670 GTGTGGCCTGTGCTGGACCCTGG + Intronic
996742248 5:126811208-126811230 CTGTGGCCTCACAGGGAGCCAGG + Intronic
998818389 5:146036028-146036050 TTGTGGCCTTTAATGAGGCCTGG + Intronic
999190446 5:149743079-149743101 CTCTGGCCTTCCCTGGAGCCTGG + Intronic
999329592 5:150663265-150663287 GTGAGGCCTTAGATGAAGCCAGG - Intronic
1001426160 5:171623959-171623981 AGGGGGCCTTTGATGGGGCCGGG + Intergenic
1001527026 5:172436393-172436415 CTGTGGCCGGTGAAGGAGCCCGG - Intronic
1005823134 6:29614560-29614582 CACTGGGCTTTGAAGGAGCCTGG + Intronic
1005839347 6:29731382-29731404 CTTTGGCCTTGGACTGAGCCAGG - Intronic
1007214855 6:40229007-40229029 CTGAGGCCCTTCAGGGAGCCCGG + Intergenic
1009257170 6:61424154-61424176 CTGTGGCCTTCGTTGGAAACGGG + Intergenic
1009534250 6:64860625-64860647 CTGTGGCCCTTCAGGGAGCCCGG - Intronic
1010268694 6:73896296-73896318 CAGTGGGCTTGGTTGGAGCCAGG - Intergenic
1011127698 6:84024356-84024378 CTGTGGCCTCAGGTGGAGGCAGG - Intergenic
1012319314 6:97823259-97823281 CTGTAGTCTTTGATGGTGCCAGG + Intergenic
1018694264 6:166379096-166379118 GTGTGGACTTTGATTGGGCCTGG - Intronic
1018837058 6:167493010-167493032 CTGTGGGCTTTGAAGCAGCATGG - Intergenic
1019383345 7:739807-739829 CTCTGGGCCTTGTTGGAGCCGGG + Intronic
1019559151 7:1647427-1647449 CTGTGGCCTCTGAGGAAGCTGGG - Intergenic
1023880727 7:44319560-44319582 CTGTGGCCTTTGACCGCGGCAGG + Intronic
1024223482 7:47305599-47305621 GTGTGGCCTTTGAAGCAGCGGGG - Intronic
1028018703 7:85744881-85744903 CTGTGCTCTTTGTTGGAGGCAGG - Intergenic
1028912571 7:96224920-96224942 GTGTTGCCTGTGATGGAGCTGGG - Intronic
1029820880 7:103145729-103145751 CTCTGGCTGATGATGGAGCCTGG + Intronic
1030872419 7:114773555-114773577 TTGTGGCTATTGATGTAGCCAGG - Intergenic
1032080556 7:128856503-128856525 CCGTGGCCTTTGCAGGAGACGGG + Exonic
1034263114 7:149769292-149769314 CTGTGGGCCCTGCTGGAGCCAGG - Intronic
1034472863 7:151264871-151264893 CTGTGGCTCTTCATGGAGCCAGG + Intronic
1035729769 8:1845844-1845866 ATGTGGCCTCTGATGGAGGCAGG + Intronic
1038741319 8:30219480-30219502 CTGTGGCCTTAGAGGGACCTGGG + Intergenic
1041773363 8:61496839-61496861 CTGTGGCCTTTGGTATACCCAGG + Intronic
1043820290 8:84854947-84854969 CTGGGGTCTTTGAGGGAGCGTGG + Intronic
1044586789 8:93875890-93875912 CTGTGGCCTGTTATGAACCCAGG - Intronic
1045374633 8:101558820-101558842 TTCTGGCCGTCGATGGAGCCTGG - Intronic
1049576370 8:143391750-143391772 CTGTGGCCTTGGCTGGAGGAGGG - Intergenic
1050496155 9:6244851-6244873 CTGTGGCTTGTGTTGGATCCTGG - Intronic
1053200645 9:36149524-36149546 CTGTGGCCCTCGATGGGCCCCGG + Intronic
1053802749 9:41774627-41774649 CTGTGGCCTTTGTTGTGGACAGG + Intergenic
1054142495 9:61540443-61540465 CTGTGGCCTTTGTTGTGGACAGG - Intergenic
1054191052 9:61985973-61985995 CTGTGGCCTTTGTTGTGGACAGG + Intergenic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1054462239 9:65471593-65471615 CTGTGGCCTTTGTTGTGGACAGG - Intergenic
1054647316 9:67601744-67601766 CTGTGGCCTTTGTTGTGGACAGG - Intergenic
1057547856 9:96031537-96031559 CTGTGGACTTTGCTGATGCCGGG - Intergenic
1057548401 9:96034816-96034838 CTGTGCTCTTGGAGGGAGCCAGG + Intergenic
1058388299 9:104464219-104464241 CTGAGGCCTTTGCAGAAGCCAGG - Intergenic
1058990951 9:110255527-110255549 CGGTGGGTTTTGCTGGAGCCAGG - Intronic
1059359269 9:113727752-113727774 CTGTGTCCTTTCATGGTGGCAGG + Intergenic
1059676846 9:116548222-116548244 CCACGGCCTCTGATGGAGCCAGG - Intronic
1061461258 9:130741230-130741252 CTGTGGCATTTGTGGGTGCCAGG - Intronic
1062038692 9:134394395-134394417 CAGTGGCCCTTCATGGAGACAGG - Intronic
1062130903 9:134892544-134892566 GGGAGGCCTTTGCTGGAGCCTGG - Intergenic
1062166904 9:135112509-135112531 TGGTGGCCCTTGATGGAGCTTGG + Intronic
1062466818 9:136685269-136685291 CTGGGGCCTCTGATGGTGCTTGG - Intronic
1062569503 9:137178636-137178658 CTCTGGCCTGTGATACAGCCTGG - Intronic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1203403486 Un_KI270522v1:254-276 TTGTGGCCTTTGTTGGAAACGGG - Intergenic
1186690778 X:11973425-11973447 GTGTGGACCTTGATGTAGCCAGG + Intergenic
1190108353 X:47574249-47574271 CAGAGGCCTTTGGCGGAGCCGGG + Exonic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1192317271 X:70062789-70062811 CTGTGGGCTTTGGAGGAGCGGGG - Exonic
1195460593 X:105119056-105119078 CTTTGACCTGTGATGTAGCCAGG + Intronic
1195727449 X:107933113-107933135 TTGTTCCCTTTGAAGGAGCCTGG - Intergenic
1196883802 X:120224010-120224032 CTGTGCTCTTCGAGGGAGCCAGG - Intergenic
1197478537 X:126952713-126952735 CCGGGGCCTTTCATGGAGCGGGG + Intergenic
1201293175 Y:12441629-12441651 CTGTGGTGTGTGATGAAGCCTGG + Intergenic