ID: 967297054

View in Genome Browser
Species Human (GRCh38)
Location 3:187975539-187975561
Sequence GTGAACTAAAGCAAGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967297049_967297054 -5 Left 967297049 3:187975521-187975543 CCAAGCAAAAGGAAAAGAGTGAA No data
Right 967297054 3:187975539-187975561 GTGAACTAAAGCAAGGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967297054 Original CRISPR GTGAACTAAAGCAAGGGGAC GGG Intergenic
No off target data available for this crispr