ID: 967298367

View in Genome Browser
Species Human (GRCh38)
Location 3:187987469-187987491
Sequence ATATGCAGTCTTGCCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967298367_967298372 16 Left 967298367 3:187987469-187987491 CCACCTTGGGCAAGACTGCATAT No data
Right 967298372 3:187987508-187987530 CAAATGCTGTCTCTGCTGTGTGG No data
967298367_967298369 -10 Left 967298367 3:187987469-187987491 CCACCTTGGGCAAGACTGCATAT No data
Right 967298369 3:187987482-187987504 GACTGCATATCTTTCCAGATTGG No data
967298367_967298373 17 Left 967298367 3:187987469-187987491 CCACCTTGGGCAAGACTGCATAT No data
Right 967298373 3:187987509-187987531 AAATGCTGTCTCTGCTGTGTGGG No data
967298367_967298370 -9 Left 967298367 3:187987469-187987491 CCACCTTGGGCAAGACTGCATAT No data
Right 967298370 3:187987483-187987505 ACTGCATATCTTTCCAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967298367 Original CRISPR ATATGCAGTCTTGCCCAAGG TGG (reversed) Intergenic