ID: 967299251

View in Genome Browser
Species Human (GRCh38)
Location 3:187996379-187996401
Sequence TTTCTAGAAGAGCTGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967299247_967299251 8 Left 967299247 3:187996348-187996370 CCTGCAGGCCTTGTGAGATAAGA No data
Right 967299251 3:187996379-187996401 TTTCTAGAAGAGCTGTCCTCTGG No data
967299250_967299251 0 Left 967299250 3:187996356-187996378 CCTTGTGAGATAAGACAGGGACA No data
Right 967299251 3:187996379-187996401 TTTCTAGAAGAGCTGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967299251 Original CRISPR TTTCTAGAAGAGCTGTCCTC TGG Intergenic
No off target data available for this crispr