ID: 967310298

View in Genome Browser
Species Human (GRCh38)
Location 3:188099801-188099823
Sequence TAGGAAGAACATTATGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967310292_967310298 26 Left 967310292 3:188099752-188099774 CCTAAAACAATAATAGTAAAACA No data
Right 967310298 3:188099801-188099823 TAGGAAGAACATTATGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967310298 Original CRISPR TAGGAAGAACATTATGGGTT GGG Intergenic
No off target data available for this crispr