ID: 967316202

View in Genome Browser
Species Human (GRCh38)
Location 3:188154069-188154091
Sequence CGCGGGCGGCGCGCTCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967316195_967316202 4 Left 967316195 3:188154042-188154064 CCGGGGCGCGGGGCGTGGGGCGC 0: 1
1: 1
2: 11
3: 77
4: 487
Right 967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG 0: 1
1: 0
2: 3
3: 22
4: 170
967316194_967316202 5 Left 967316194 3:188154041-188154063 CCCGGGGCGCGGGGCGTGGGGCG 0: 1
1: 4
2: 19
3: 93
4: 649
Right 967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG 0: 1
1: 0
2: 3
3: 22
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967316202 Original CRISPR CGCGGGCGGCGCGCTCGAGG AGG Intronic
901361226 1:8702968-8702990 TGCGGGCGGGGGGCTCGGGGTGG - Intronic
901934561 1:12618567-12618589 CGCGGGCGGCCCGGGCAAGGAGG - Intergenic
904751241 1:32742263-32742285 CGCGCGCGGCGTGTTGGAGGGGG + Intronic
905179163 1:36156043-36156065 CGCGGACGGCGCGGGCGCGGGGG + Intronic
905449124 1:38046065-38046087 CGCGGGCGGCCTGCACGCGGCGG - Exonic
905648288 1:39639710-39639732 CGGTGGCGGCGCCCCCGAGGCGG - Exonic
905847146 1:41242312-41242334 GCGGGGCGGCGCGCTGGAGGAGG + Intergenic
912492106 1:110068121-110068143 CGCGGGCGGCGGACTGCAGGCGG + Intronic
915247669 1:154567991-154568013 CCCCGGCGGCGCGCTCCAGCCGG + Exonic
918093691 1:181317697-181317719 CACGGGCGGCACGCGCGAGGCGG - Intergenic
918332125 1:183471456-183471478 GGCGGGCGGCGGGCTGGAGTCGG - Intergenic
923490260 1:234478338-234478360 CGCCCGCGGCGCGCGCGAGGCGG - Exonic
923505235 1:234600034-234600056 CGCGGGCGGGGGGCGCGAGGAGG + Intergenic
923650134 1:235866500-235866522 CGCGGGGGGCGAGGTCGAGCAGG - Intronic
923744401 1:236686813-236686835 CGCGGGCCGCCCGCGCGTGGTGG + Intronic
1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG + Intergenic
1064086597 10:12350054-12350076 CGCGTCGGGCGCGCTCGGGGGGG - Intronic
1068955280 10:62815332-62815354 CGCGGGCGGCGGGCAGGTGGGGG + Intronic
1069664490 10:70145665-70145687 CGCGGGCGGCGCGGAAAAGGGGG + Exonic
1072169792 10:92848422-92848444 CGGGGGCGGGGCGCTCGGGCCGG - Intronic
1073403440 10:103277077-103277099 CTGGGGCGGCGCGCTGGGGGCGG - Intergenic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1077285603 11:1763977-1763999 CGCGGCCGGCGTGCGCGGGGCGG + Exonic
1077630544 11:3808529-3808551 CGGGGCCGGCGCTCTCGGGGCGG - Exonic
1080386973 11:31816167-31816189 AGGGGGCAGCGCGCGCGAGGCGG - Intronic
1080403510 11:31958254-31958276 TGCGGGCTGCACGCTGGAGGTGG - Intronic
1083648460 11:64186419-64186441 CGCGGGCGGCGGGCGGGAGCGGG + Intronic
1084588735 11:70078407-70078429 CCCGGCCCGCGCGCTCGATGCGG - Exonic
1089397482 11:118145678-118145700 GACGGGCGGGGCGGTCGAGGAGG + Intronic
1089993465 11:122883001-122883023 GGTGGGCGGCGCGCCCGGGGAGG + Intronic
1091290723 11:134438078-134438100 CGCGGGCGTTGCGTTCCAGGTGG + Intergenic
1091616527 12:2054141-2054163 CCTGGGCGGCGCGCTCCAGGTGG + Intronic
1096806949 12:54146735-54146757 CGCTGGGGGCTCACTCGAGGAGG + Intergenic
1097187439 12:57203269-57203291 CGCGGACGGCTCGGACGAGGTGG + Exonic
1098543516 12:71686090-71686112 AGCGGGCGAGGCGCTAGAGGCGG + Exonic
1101253625 12:102957371-102957393 AACAGGCGGCGCGCTCGGGGCGG - Intronic
1102197123 12:111033907-111033929 CGCGGGCGGAGCGCGCCGGGCGG - Intergenic
1102254080 12:111406133-111406155 CGCTCGCGGCTCGCTCGAGCGGG - Exonic
1103488192 12:121296736-121296758 CCCGGGCGGCGGGCGCGCGGGGG + Intronic
1104961266 12:132489719-132489741 TGCGGGCGGCGCTCTCCAAGCGG - Exonic
1105011933 12:132761888-132761910 TGACGGCGCCGCGCTCGAGGCGG + Exonic
1108292496 13:48975812-48975834 CCGGCGCGGCGGGCTCGAGGCGG + Intergenic
1110705975 13:78602263-78602285 CGCGGGCGGCGCGGGCGCGGCGG - Exonic
1113861528 13:113490581-113490603 CGCAGGCGGCGCGCTGGATGTGG - Intronic
1117876038 14:60250067-60250089 CCGGGGCGGCGCGCCCGAGCGGG - Intronic
1122582079 14:102777383-102777405 CGCGGGCGGCGGGGGCGGGGCGG + Intergenic
1125674161 15:41493783-41493805 GGCGGGGGGCGCGGCCGAGGCGG + Intronic
1126668425 15:51094703-51094725 CGCGGGCGGCGCGGGCTGGGCGG + Intronic
1128067739 15:64775235-64775257 CTCCGGCGGCGCCCTGGAGGAGG - Exonic
1129539395 15:76338438-76338460 CGGCCGCGGCGCGCTCGAGCAGG - Exonic
1129710747 15:77819270-77819292 CGCGGACGGCGCGCCCGGGACGG - Intronic
1130076540 15:80695116-80695138 GGGGGGCGGCGCGCACGAGCCGG + Intronic
1131508632 15:93036712-93036734 CTGGGGCGGGGCGCTCCAGGGGG - Intronic
1132111521 15:99105329-99105351 CGCGGCCGGCGCGGGCGAGAGGG + Exonic
1132365258 15:101252094-101252116 CGCGGGCGGGGCGCCCGAGAGGG - Intergenic
1132719682 16:1309611-1309633 CGCGGGCGGGGCGCGCGGGGCGG - Intronic
1133303946 16:4798577-4798599 CGCTGGCGGCGATCTCGGGGAGG + Exonic
1134070057 16:11255368-11255390 CGCGGGGGCCGCGGGCGAGGAGG + Exonic
1135517607 16:23148917-23148939 AGCGGGCGGCGCGGGAGAGGCGG + Exonic
1135691214 16:24539521-24539543 CACGGGCGGCGCGCGCGAGGCGG - Intronic
1135745724 16:25015024-25015046 CCCGAGCGCCGCGCTCCAGGCGG - Intronic
1136428180 16:30183176-30183198 CGCGGGGGGCGCGGGCGAGGAGG - Intronic
1137655234 16:50153456-50153478 CGCGGGCGGCGCGGTCGCGCAGG - Intronic
1142860000 17:2755669-2755691 CGCGGGCCGCACGGTGGAGGAGG - Intergenic
1142876308 17:2853683-2853705 CGCGGGCGGCGCGTCTGAGCGGG + Intronic
1143099870 17:4499077-4499099 GGCGGGCGGCGCGGAGGAGGAGG + Exonic
1145190752 17:20841219-20841241 CGGGTGCGGTGCGCCCGAGGAGG - Intronic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1146058669 17:29593458-29593480 CGGGGGCGGCGCGCCCGGCGCGG - Exonic
1146062206 17:29613347-29613369 CGTGGGCGGGGCGCTCCTGGGGG - Exonic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1146794273 17:35770149-35770171 CGCGCGCGGCGCGGGCGAGTGGG + Exonic
1147875859 17:43619894-43619916 GGCGGGCAGCGGGCTGGAGGAGG - Intergenic
1150168385 17:62966307-62966329 GGCGGGCGGCTCGCGCGAGGCGG - Intergenic
1150561964 17:66302476-66302498 CGCGGGCCGGGCGCGCGCGGGGG - Intergenic
1150790082 17:68196379-68196401 CGGGAGCCGCGCGGTCGAGGAGG + Intergenic
1152124982 17:78441245-78441267 CCAGGGCGGGGCGCTCGGGGTGG + Intronic
1152161877 17:78673999-78674021 CTCAGGCGGGGCCCTCGAGGTGG - Intergenic
1154196600 18:12271687-12271709 CGCCGGCCACGCGCTCCAGGGGG + Intronic
1155199354 18:23503596-23503618 GGCGGGCGCCGCGCCCGCGGCGG - Exonic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1157753004 18:50194949-50194971 CGCGGCCGGCTCGCTCCCGGCGG + Exonic
1160873257 19:1286398-1286420 CGGCGGCGGCGCGCGCGTGGGGG - Intronic
1161095017 19:2385186-2385208 CGCGGGGGCGGGGCTCGAGGGGG + Intergenic
1161450668 19:4343727-4343749 GGCGGGCGGTGCGGGCGAGGAGG + Exonic
1162352635 19:10159971-10159993 CGGTGGCGGCGCTCACGAGGCGG - Intronic
1162809119 19:13153761-13153783 CGCGGGCGGCGCCGTCGGAGGGG - Exonic
1163252159 19:16132388-16132410 CGTGGGCGGGGCGTTGGAGGTGG - Exonic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1163681279 19:18683926-18683948 CGGGGGCGGGGCGCGCGCGGCGG + Intronic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1165157145 19:33795802-33795824 CGCGCGCGGCGCGATGGAGACGG - Intergenic
1165431447 19:35775726-35775748 CGGGGGCGGGGCGCGCGGGGCGG - Intronic
1166869751 19:45864224-45864246 CGAGGGCGGCGCGCTCGGACTGG - Intronic
1167040604 19:47020778-47020800 GGCGGGCGGCGCGGGGGAGGCGG + Intronic
1167377337 19:49119215-49119237 CGCGGGCGGAGAGCGAGAGGCGG - Intergenic
1167455947 19:49596801-49596823 CGCGGGTGGCTGGCTCAAGGAGG - Exonic
1168307314 19:55442647-55442669 CGCGGGCGGGGCGGGCGCGGCGG - Exonic
1168332679 19:55579249-55579271 CGCGGGCGGCGAGGTCGAGCTGG - Exonic
1168536103 19:57172082-57172104 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536110 19:57172099-57172121 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536117 19:57172116-57172138 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536124 19:57172133-57172155 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536131 19:57172150-57172172 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536138 19:57172167-57172189 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536145 19:57172184-57172206 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
1168536152 19:57172201-57172223 AGGGGGCGGGGCGCGCGAGGGGG + Intergenic
926727981 2:16013345-16013367 CGCGGGCGGCGTTGTCGCGGTGG - Intergenic
928606421 2:32947849-32947871 CGCGGGCGGTGCGCGCGAGGCGG - Intronic
929252932 2:39779286-39779308 CGCGAGCGGCTCGCTCCTGGAGG + Intergenic
932757908 2:74421674-74421696 CGCGGGCGGCGCGGTTGCCGGGG - Intronic
934079017 2:88452164-88452186 CGCGGGCGCGGCGGGCGAGGCGG + Exonic
937368858 2:121284544-121284566 GGCGGGCGGCGGGCTCGGAGGGG - Intronic
940353831 2:152717906-152717928 CGCGCGCGCGGTGCTCGAGGCGG + Exonic
940883316 2:158968509-158968531 CGCGGGAGGCGCGGCCGGGGCGG + Intergenic
941906164 2:170717050-170717072 GGCGGGCGGCGCCCCCGAGGCGG + Exonic
942276320 2:174326528-174326550 CGGGGGCGGGGCTCTGGAGGTGG - Intergenic
942928123 2:181457465-181457487 CGCGGGCGGAGCGTTCGGGCCGG - Exonic
945241632 2:207681708-207681730 CCCGGGCGGCGCGGACGATGAGG + Intergenic
947765211 2:232633534-232633556 GGCGGGCGGGGCGGTCGGGGCGG - Exonic
1169278607 20:4249295-4249317 CGCGGGGGGCGGGACCGAGGAGG + Intergenic
1174054045 20:47785801-47785823 AGCGCGCGGAGGGCTCGAGGAGG - Intronic
1176549961 21:8216886-8216908 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
1176568887 21:8399920-8399942 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
1176576801 21:8444155-8444177 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
1178351093 21:31873511-31873533 CGCGGGGGGCGTGATCGCGGCGG + Exonic
1179522440 21:41953970-41953992 CGCGGGCGGGACGCCCGGGGCGG - Intergenic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1184086924 22:42270747-42270769 CGGGGGCGGGGCGCTGGGGGCGG + Intronic
1184508088 22:44916426-44916448 CGAGGGCGGCGGGCTCGGCGAGG + Exonic
1184680914 22:46071712-46071734 CGCGGCCGGCGCGCTCGGGCGGG + Intronic
1185268660 22:49918445-49918467 CGCGGGCTGCGCGCGAGGGGCGG + Exonic
1203254851 22_KI270733v1_random:133212-133234 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
1203262907 22_KI270733v1_random:178291-178313 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
950438463 3:12994100-12994122 CGGGGACGGCGCGCTCTCGGCGG - Intronic
952241144 3:31532609-31532631 GGCGGGCGGCGGGCTAGAGAGGG + Intergenic
953099230 3:39809399-39809421 CGCGGGCGGCACGCGCCGGGAGG - Intronic
953925341 3:46979799-46979821 GGCGGGCGGCGCGGAGGAGGCGG + Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
958814610 3:98901716-98901738 CGTGGCCGGCGCGCGCGAGAGGG - Intergenic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
968010437 3:195270849-195270871 CGCGGGCGGCGAGGGCGCGGCGG + Exonic
968084757 3:195869317-195869339 TCCGGGGGGCGGGCTCGAGGGGG + Intronic
968890450 4:3366023-3366045 TGCGTGGGGCGTGCTCGAGGTGG + Intronic
968965081 4:3765728-3765750 CGCGGGGCGCGCGCTCGGCGAGG - Intergenic
973945237 4:55948759-55948781 CGCGGGCGCCGACCTCCAGGGGG + Intergenic
976184168 4:82429198-82429220 CGCGTGCGGCGCGCTGGGGGAGG + Intronic
978126992 4:105146723-105146745 GGCGCGCGGCGCTCGCGAGGAGG - Exonic
980923861 4:139115232-139115254 CCCGGGCGGCGCGGACGATGAGG - Intronic
984936801 4:184897175-184897197 CCCGGGCGTCCCCCTCGAGGGGG - Intergenic
985588007 5:750923-750945 CGCGGGAGGCAGGCTCGGGGAGG - Intronic
985602676 5:843390-843412 CGCGGGAGGCAGGCTCGGGGAGG - Intronic
985611630 5:892663-892685 CGCCGGCGGCGGGCCCGAGGCGG + Exonic
986330495 5:6713588-6713610 GGCGGGCGGCGGGGCCGAGGGGG - Intergenic
990210770 5:53480148-53480170 CGCGGTGGGGGCGCTGGAGGCGG - Intergenic
992400045 5:76403504-76403526 CGCGGGGGGCGCGCCCCGGGCGG + Exonic
993519459 5:88883236-88883258 CGAGGGGAGCGCGCGCGAGGGGG + Intronic
994367297 5:98929648-98929670 CACGGGCGGGGCGCCGGAGGAGG + Intergenic
1002131773 5:177086679-177086701 CGGGGGCGGGGCTCTCCAGGTGG + Intergenic
1003175837 6:3751796-3751818 CGCGGGAGGCGGGCGGGAGGCGG - Exonic
1004216756 6:13711194-13711216 AGCGGGCGGCCCGCTGGCGGGGG + Exonic
1006472291 6:34235857-34235879 CGCGGGAGGTGCGCCCGAGAAGG + Intergenic
1016982162 6:149863759-149863781 CGCGGGCGGCGGCCCCCAGGAGG - Exonic
1016992264 6:149938436-149938458 CGCGAGCGGCGGGGTCGGGGAGG + Intergenic
1016994818 6:149954376-149954398 CGCGAGCGGCGGGATCCAGGAGG + Intergenic
1017007462 6:150038176-150038198 CGCGAGCGGCGGGGTCGGGGAGG - Intergenic
1018682548 6:166275823-166275845 CGCGGGCGGCGGGCGGCAGGCGG - Intergenic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019298222 7:290105-290127 GGCGGGCGGCGCGGAGGAGGCGG + Intergenic
1019531172 7:1504202-1504224 CGCGGACGCCGGGCTGGAGGCGG + Intronic
1021969388 7:25951441-25951463 GGAGGGCGGGGCGCTCCAGGTGG + Intergenic
1029640439 7:101816478-101816500 CGCGGGGTGCGCGCGCGAGCGGG + Intronic
1029735707 7:102464827-102464849 CGCGGACGGCGCGATGGCGGCGG - Exonic
1031997244 7:128240927-128240949 CGCGCGGGGCGCGGTCGGGGCGG - Intergenic
1035388434 7:158489768-158489790 CGCAGGCTGCCTGCTCGAGGAGG - Exonic
1035751846 8:2002050-2002072 CGCGGCCGGCGCGCAGGCGGCGG - Exonic
1036784980 8:11680108-11680130 CGCGGGCTGCGCGCTCTGGGTGG - Intronic
1037768991 8:21788088-21788110 TGCGGGCGGCGAGCTCGAGGGGG - Intronic
1039921229 8:41895970-41895992 CGGGTGCGGCGCGCCCGAGCAGG + Intronic
1041281038 8:56211423-56211445 CTCGGGCGGAGCGCGCGCGGGGG - Intergenic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1049647079 8:143740292-143740314 TGAGGGCGGCGCGCGCGGGGCGG - Intergenic
1049762751 8:144338381-144338403 CCCGCGCGGCGCGGCCGAGGGGG - Intergenic
1057207899 9:93184452-93184474 CGCGGGAGGGGCGCGCGGGGAGG - Intergenic
1057245570 9:93451805-93451827 CGGGGGCGGCGGCCTCTAGGGGG - Exonic
1058663118 9:107283763-107283785 GCCGGGCGGCGCGCTCCAGCGGG + Intronic
1060979962 9:127786124-127786146 CGGCGGCGGCGCGTTGGAGGCGG + Exonic
1062022584 9:134326414-134326436 CGCGGGCCGGGCGCGCGCGGCGG + Intronic
1203471252 Un_GL000220v1:116357-116379 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
1203479073 Un_GL000220v1:160329-160351 AGCGAGCGGCGCGCGCGGGGTGG - Intergenic
1185736649 X:2500945-2500967 CGCGGGCGGCGCGGAAGCGGCGG - Exonic
1186669965 X:11758210-11758232 GGCGGGCGGAGCGCGCGCGGTGG - Exonic
1187031541 X:15493312-15493334 CGCGGCCGGCGGCCTAGAGGAGG + Exonic
1192146205 X:68684550-68684572 CGCGGGCGGCGTGGGGGAGGGGG + Intronic
1196684128 X:118496098-118496120 CCCGGGGGACGCGCTCCAGGCGG + Intronic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic