ID: 967316373

View in Genome Browser
Species Human (GRCh38)
Location 3:188154638-188154660
Sequence GCTGAGGCCCAGAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1269
Summary {0: 1, 1: 0, 2: 15, 3: 197, 4: 1056}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967316360_967316373 21 Left 967316360 3:188154594-188154616 CCTAGACCCAGTCCTCCAAGTCC 0: 1
1: 0
2: 2
3: 20
4: 244
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316363_967316373 9 Left 967316363 3:188154606-188154628 CCTCCAAGTCCTCCCATTTTACA 0: 1
1: 0
2: 5
3: 17
4: 255
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316361_967316373 15 Left 967316361 3:188154600-188154622 CCCAGTCCTCCAAGTCCTCCCAT 0: 1
1: 0
2: 8
3: 24
4: 312
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316368_967316373 0 Left 967316368 3:188154615-188154637 CCTCCCATTTTACAGTTGGGGCA 0: 1
1: 3
2: 10
3: 102
4: 459
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316364_967316373 6 Left 967316364 3:188154609-188154631 CCAAGTCCTCCCATTTTACAGTT 0: 1
1: 1
2: 3
3: 43
4: 348
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316369_967316373 -3 Left 967316369 3:188154618-188154640 CCCATTTTACAGTTGGGGCAGCT 0: 1
1: 3
2: 38
3: 526
4: 2885
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316370_967316373 -4 Left 967316370 3:188154619-188154641 CCATTTTACAGTTGGGGCAGCTG 0: 1
1: 3
2: 49
3: 625
4: 3242
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056
967316362_967316373 14 Left 967316362 3:188154601-188154623 CCAGTCCTCCAAGTCCTCCCATT 0: 1
1: 0
2: 3
3: 37
4: 307
Right 967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG 0: 1
1: 0
2: 15
3: 197
4: 1056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967316373 Original CRISPR GCTGAGGCCCAGAGAGAAGG AGG Intronic
900125198 1:1065833-1065855 GCTGAAGCAGAGAGAGAAGGCGG + Intergenic
900315327 1:2053456-2053478 GCTGAGGCCAACAGAGACGCAGG + Intronic
900357284 1:2271003-2271025 ACTGAGGCCCAGTGAGGAGTGGG + Intronic
900416924 1:2539643-2539665 GCTGAGGCTCAGAGAGGAGTGGG - Intergenic
900457472 1:2784232-2784254 GCTGAAGCAGAGATAGAAGGTGG + Intronic
900869696 1:5293198-5293220 ACAGAGGCCCAGAGGGAAGGAGG + Intergenic
901204622 1:7486946-7486968 GCTGAGGCCCAGAGAGGCTGAGG - Intronic
901537083 1:9889472-9889494 GCAGAGGCCCAGAGATGTGGAGG - Intronic
901636919 1:10674821-10674843 GGTGAGGCCCAGGAAGAAGTTGG - Intronic
901671996 1:10861565-10861587 ACTGAGGCCCAGAGAGGATAAGG - Intergenic
901782507 1:11603059-11603081 ACTGAGGCCCAGAGAGCTTGGGG + Intergenic
901874826 1:12161522-12161544 GCTGAAGCCCAGAGAGGGGTAGG + Intergenic
901935743 1:12625482-12625504 ACTGAGGCCCAGAGAGGACGGGG + Intergenic
902041646 1:13496882-13496904 GCTGCGGCCCAGGGAGAAGGTGG + Intronic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902374535 1:16024087-16024109 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902379476 1:16045851-16045873 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902518995 1:17005237-17005259 GCTGAGGTCCAGAGAAGAGCGGG + Intronic
902627359 1:17684368-17684390 GCGGAGGGCTAGAGAGATGGGGG + Intronic
902690093 1:18105747-18105769 GATGAGGGCCAGGGAGCAGGTGG - Intergenic
902706987 1:18212520-18212542 ACTGAGGCCCAGAGAGGAGTAGG + Intronic
902735071 1:18395162-18395184 ACTGAGGCCCAGAGGGAGAGAGG + Intergenic
902758086 1:18562397-18562419 ACTGAGGCCCAGAAAGGAAGTGG - Intergenic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
902957657 1:19936817-19936839 ACTGAGGCCTAGAGAGGAGCAGG + Intergenic
903016400 1:20364914-20364936 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
903342036 1:22660712-22660734 ACTGAGGCTCAGAGAGAGGCAGG + Intronic
903465003 1:23545882-23545904 GCTGAGACCCAGAAATAAGAAGG - Intergenic
903470400 1:23582883-23582905 ACTGAGGCCAAGTGAGGAGGGGG + Intronic
903497427 1:23778896-23778918 ACTGAGGCCTAGAGGGAACGGGG + Intronic
903542148 1:24102460-24102482 ACTAAGGCCCAGAGAGAGGGAGG - Intronic
903577105 1:24345758-24345780 GCTGAGGCTCAGAGAGGTGAAGG - Intronic
903620426 1:24694109-24694131 ACTGTGGCCCAGAGAGGAGCAGG - Intergenic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903653222 1:24933457-24933479 TGTGAGGCCCAGAGAGAGGAGGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903686860 1:25138246-25138268 ACTGAGGCTCAGAGGGAAAGTGG + Intergenic
903708909 1:25307228-25307250 CCTGAGGCCCAGAGAGGGGTGGG + Intronic
903788528 1:25876525-25876547 CCTGTGGCCCAGAGAGAACAAGG - Intergenic
903889561 1:26560552-26560574 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
903936329 1:26897591-26897613 GCTGATGCCCAGAGGGAATGTGG - Exonic
904009220 1:27380447-27380469 CATGAGGCCCAGAGAGAATGTGG - Intronic
904358846 1:29959569-29959591 GCTGAGGCCAGCAGAGCAGGAGG + Intergenic
904415679 1:30359880-30359902 ACTGAGGCCCAGAGAAGAGGAGG + Intergenic
904488916 1:30846152-30846174 ACTGAGGCTCAGAGAGACCGTGG - Intergenic
904684719 1:32251706-32251728 CCTGAGGCCCAGAGAGAACAAGG + Intronic
904713444 1:32448889-32448911 GCTGAGGCGGAGAGAGAGAGGGG - Intergenic
904813105 1:33176601-33176623 GCTGACGCCCCGAGGGCAGGTGG - Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
904924125 1:34032640-34032662 GATGAGGCGCAGAGAGAGGGTGG + Exonic
904925178 1:34041965-34041987 GCTGATCCTCAGAGAGGAGGAGG + Intronic
904949628 1:34226076-34226098 GCTGCTGCCCAAAGAGAAGAGGG + Intergenic
905251095 1:36648958-36648980 GCCAAGCCCAAGAGAGAAGGAGG - Intergenic
905416405 1:37807698-37807720 ACTGAGGCGCAGAGAGCGGGAGG - Intronic
905473475 1:38209726-38209748 ACTGAGGCTCAGAGAGGAGATGG + Intergenic
905590429 1:39158644-39158666 GCTGGGGTCTAGAGAGAAGGTGG + Intronic
905679267 1:39855833-39855855 ACTGAGGCCCAAAGAGTAGAAGG - Intronic
905872538 1:41413308-41413330 ACTGAGGCTCAGAGAGAGAGAGG - Intergenic
906256557 1:44355080-44355102 GCTGAGGCCGAGGGAGACGTCGG - Exonic
906280209 1:44548077-44548099 TGTGAGGCCAAGAGAGAAGACGG - Intronic
906290097 1:44614229-44614251 GCTGAGGCCCAGTGAGCTGCAGG + Exonic
906674684 1:47684759-47684781 GCTGTAGCCCAGAGAGGTGGAGG - Intergenic
906710039 1:47922585-47922607 GCTGAGGCTCAGAGAGACCCAGG - Intronic
906723673 1:48027854-48027876 GCTGGGGGCCAGGGAGCAGGAGG - Intergenic
906919060 1:50044042-50044064 ACTGAGGCTCAGAGAGAAAAAGG + Intergenic
906948783 1:50317742-50317764 ACTGAGGCCCAGAGAGGAAAAGG + Intergenic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907454104 1:54564357-54564379 GCTGTGGCCCAGAGAGGACCAGG + Intronic
907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG + Intergenic
908008169 1:59748230-59748252 GGTGAGGACCACAGAGAAGCAGG + Intronic
908475189 1:64480245-64480267 ACTGAGGCCCAGCGAGGAAGTGG + Intronic
908722998 1:67146478-67146500 CCTGAGTCCTAGAGTGAAGGGGG - Intronic
908984614 1:70002276-70002298 TCTGATGCCCATAGAGAAGAAGG - Intronic
909357097 1:74722195-74722217 ACGGAGGCCCAGAAAGGAGGGGG + Intronic
910170117 1:84368482-84368504 TGTGAGTCCAAGAGAGAAGGTGG - Intronic
910425951 1:87120197-87120219 GCTGAGGCTGTGAGAGGAGGTGG - Intronic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912632389 1:111256910-111256932 ATTGAGGCTGAGAGAGAAGGAGG + Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
912827083 1:112915410-112915432 GCTGGGGCACAGAGAGCAGGAGG + Intronic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
913090524 1:115473740-115473762 GGTGAGATCCAGAGAGAAGCAGG + Intergenic
913263936 1:117026156-117026178 GCTGGGGTTCAGGGAGAAGGTGG + Intronic
913356592 1:117929413-117929435 ACTGAGGCCGGGAGGGAAGGCGG - Intronic
914807025 1:150999150-150999172 GCTGGGTCCCAGAGTGAAGATGG + Intronic
914982916 1:152430973-152430995 CCCAAGGCCCAGAGAGATGGTGG - Intergenic
915580141 1:156808588-156808610 GCAGAGGCCGAGGGAGAGGGTGG + Intronic
915621633 1:157089742-157089764 TCACAGGCCCAGAGAGAAGAAGG - Intergenic
916189886 1:162168429-162168451 GCTGAGGACCAAAGAGAAACAGG - Intronic
917793945 1:178519129-178519151 GGTGGGGCCCAGGGAGCAGGTGG + Intronic
918168758 1:181975301-181975323 GCTCAGGCCCAGGGAGATTGGGG - Intergenic
919567448 1:199206794-199206816 GCTGAGGAGGAGAGATAAGGAGG + Intergenic
919746003 1:201009513-201009535 GGTCAGGCCCAGCTAGAAGGGGG + Intronic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
919909904 1:202104545-202104567 GTAGAGGCACAGACAGAAGGAGG + Intergenic
919923377 1:202179159-202179181 GCTGAGGCACTGAGAGGAGTGGG - Intergenic
920053372 1:203176326-203176348 GCTGAGGGCCCTAGAGAGGGAGG + Intergenic
920068263 1:203284516-203284538 TCTGAGACCCAGAGAGTCGGTGG + Intergenic
920097608 1:203496751-203496773 ACTGGGGCCCAGAGAGGAGAGGG - Intronic
920114078 1:203607589-203607611 GCTGAGACCCAGAGAGCTGAAGG - Intergenic
920206998 1:204299473-204299495 GCTAAGGTCCATAGGGAAGGTGG + Intronic
920560687 1:206936338-206936360 GCTGAGATCCAGAGAGAAGCAGG + Intronic
920598496 1:207297770-207297792 GCTGAGGGCCAGAGAGGTTGAGG - Intergenic
920801646 1:209194051-209194073 GCTGAGGCCCAGAGAGGGCATGG - Intergenic
920982584 1:210852234-210852256 GCAAAGGCCCAGAGGGAAGGAGG + Intronic
921151912 1:212409495-212409517 GCTGAGGGCCAGAGAAAAAGGGG + Intronic
921164751 1:212498773-212498795 GCTGAGGCCCAGCAAGAGGGAGG - Intergenic
921185255 1:212665015-212665037 GTTGAGGCTCAGAGAGACGCGGG + Intergenic
921191257 1:212710704-212710726 GCTGTGGCCCAGATGAAAGGAGG - Intergenic
921355708 1:214282284-214282306 ACTAAAGCCCAGAGAGAAAGTGG + Intronic
922216726 1:223526107-223526129 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
922496728 1:226062990-226063012 GCTGAGGCGGCGAGAGACGGGGG - Intronic
922593794 1:226798508-226798530 GCTGGGGCCCAGGAAGGAGGCGG - Intergenic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
922855812 1:228773908-228773930 GCTAAGGCCCAGCGAGAAATCGG - Intergenic
923503894 1:234589341-234589363 GAAGAGGCCTAGAGAGAGGGCGG + Intergenic
923505953 1:234607475-234607497 GCTGGGCCCCAGAGAGGTGGGGG - Exonic
923812473 1:237334670-237334692 GCAGACGCCCAGAGAAAACGGGG - Intronic
924517680 1:244780096-244780118 GCTGGGGGACAGTGAGAAGGTGG - Intergenic
1062788551 10:285572-285594 GCTCAGTGCCAGAGAGAATGCGG + Intronic
1063505252 10:6591953-6591975 ACTGAGGCCCAGAGAGATCATGG - Intergenic
1063970599 10:11379000-11379022 GCTGAGGCCCAGAGAGGGCAAGG - Intergenic
1063991889 10:11575267-11575289 GATGAGGCACAGAGAGAATTGGG - Intronic
1064023856 10:11830910-11830932 GCTCCTGCCCAGAGAGGAGGTGG + Intronic
1065248524 10:23785362-23785384 GCTGAGGCACAGGGGTAAGGGGG - Intronic
1065668163 10:28085255-28085277 ACTGAAGCACAGAGAGAAGTAGG - Intronic
1066658962 10:37721069-37721091 GTGGGGGCCCAGTGAGAAGGAGG + Intergenic
1066754445 10:38696554-38696576 GCTGAGACCCAGAGCAATGGGGG - Intergenic
1067067891 10:43113796-43113818 ACAGAGGCCCAGAGGGAGGGAGG - Intronic
1067107350 10:43374941-43374963 GCTGAGGCCCAGGGGAGAGGAGG - Intronic
1067156108 10:43782540-43782562 GCTGTGGCCCCAAAAGAAGGTGG - Intergenic
1067342952 10:45419272-45419294 GAAGAGGCCGAGAGAGAAAGCGG + Intronic
1067497791 10:46774986-46775008 CTTGATGTCCAGAGAGAAGGAGG + Intergenic
1067596858 10:47565428-47565450 CTTGATGTCCAGAGAGAAGGAGG - Intergenic
1067823922 10:49555749-49555771 GCTGAAGCCAAGATAGAAAGGGG + Intergenic
1067841315 10:49681705-49681727 GGTGAGGACAAAAGAGAAGGTGG - Intronic
1068676974 10:59778659-59778681 GGTGATGCCAAGAGAGAATGAGG + Intergenic
1069546714 10:69334427-69334449 GCTGAGGCCCAGAGGGACAGAGG - Intronic
1069600880 10:69706946-69706968 GCAGAGTACCAGAGAAAAGGAGG - Intergenic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069757387 10:70781685-70781707 GCTGGGGCCCAGAGAGGATGGGG - Intronic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1069941190 10:71956611-71956633 GCTGAGGCAGAGAGAGAGAGAGG - Intergenic
1070544912 10:77444753-77444775 GCTGAGTCCCAGGGAGCAGCTGG + Intronic
1070605239 10:77893844-77893866 GTTCAGGCCCAGGGAGTAGGGGG - Intronic
1070615525 10:77966765-77966787 ACTGAGGCCCAGAGGGATGTGGG + Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1070793366 10:79202903-79202925 GCTGAGGCTCAGAGAAATGGAGG - Intronic
1070802167 10:79250233-79250255 ACTGAGGCTCAGACAGAAGGGGG - Intronic
1070806931 10:79276190-79276212 ACTGAGGCCCAGAGAGTCTGTGG + Intronic
1070827858 10:79401628-79401650 ACTGAGGCCCAGAGATGGGGAGG - Intronic
1070835105 10:79443092-79443114 GCTAAGGCCCAGAGAGAGACGGG + Intronic
1070957049 10:80471076-80471098 GCTGGAGGGCAGAGAGAAGGAGG - Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072578508 10:96720677-96720699 GCTCAGGGGCAGCGAGAAGGCGG + Intergenic
1072782710 10:98261269-98261291 ACTGAGGCCCAGAGAAGGGGAGG + Intronic
1072797567 10:98367644-98367666 ACTGAGGCTCAGAGAGGAGGTGG - Intergenic
1073036069 10:100565021-100565043 GCTGAGTTCCAGAGGGAAGGGGG + Intergenic
1073077757 10:100835408-100835430 ACTGAGGCACAGAGAGAGTGAGG - Intergenic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073084233 10:100878184-100878206 ACAGAGGCCCAGAGAGAGAGAGG - Intergenic
1074249172 10:111726712-111726734 ACTGAGGCTCAGAGTGAAGAAGG - Intergenic
1074416360 10:113270337-113270359 GCTGAGGGGAAGGGAGAAGGGGG + Intergenic
1074533476 10:114312503-114312525 ACTGAGGCCCAGAGGGAATGGGG - Intronic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1074882907 10:117672399-117672421 GCTGAGGTTCAGCGAGCAGGTGG - Intergenic
1074919323 10:117991370-117991392 GCAGAGGGGCAGAGGGAAGGAGG + Intergenic
1074970316 10:118531206-118531228 GAAGAGTCCCACAGAGAAGGTGG + Intergenic
1074981495 10:118623605-118623627 GCTGAGGCCCCTTGATAAGGAGG - Intergenic
1075160747 10:120022711-120022733 TCTGAGTCCTAGAGAGAATGTGG + Intergenic
1075253629 10:120906324-120906346 GAGGAGGCCCAGAGAGCAGGGGG + Intronic
1075423452 10:122323785-122323807 GCTAAGGCCCAGGGATAATGAGG + Intronic
1075511050 10:123073359-123073381 TCTGAGGCCCAGGGAGCAGGTGG + Intergenic
1076236551 10:128868093-128868115 GCAGAGGGCAAGAGGGAAGGTGG + Intergenic
1076390943 10:130101420-130101442 ACTGAGGAGCAGAGAGAGGGTGG + Intergenic
1076450021 10:130551007-130551029 GCTGAGGCCCAGAGCCAGCGGGG - Intergenic
1076531399 10:131147615-131147637 GCCGAGGCCCAGAGAGGGGAGGG - Intronic
1076552224 10:131288730-131288752 GCAGAGACCCACAGAGAAGGCGG + Intronic
1076833664 10:133009356-133009378 GCTGGCGCCCTGAGAGAGGGTGG - Intergenic
1076918374 10:133438316-133438338 GCTGAGGCGGAGAGAGAGAGAGG - Intergenic
1076998085 11:308833-308855 GCTGGGGCCAAGGCAGAAGGAGG + Intronic
1076999306 11:314752-314774 GCTGGGGCCAAGGCAGAAGGAGG + Intronic
1077000561 11:320148-320170 GCTGAGGTCAAGGCAGAAGGAGG - Intronic
1077105220 11:839235-839257 GCTGGGGGCCAGAGGGTAGGAGG + Intronic
1077232662 11:1464981-1465003 GCAGAGAGCCAGAGAGGAGGAGG + Intergenic
1077484069 11:2830845-2830867 GCTGAGGCCTAGAGAGGGGTTGG - Intronic
1077541193 11:3147248-3147270 GCAGAGGCCCTGGGAGGAGGGGG + Intronic
1078374889 11:10785537-10785559 GCTGAGGCCCAGAGTCACCGTGG + Intergenic
1078464490 11:11540082-11540104 ACCGAGGCCCAGAGAGATGGTGG - Intronic
1078612278 11:12831012-12831034 GCAGAGAACAAGAGAGAAGGAGG - Intronic
1078886188 11:15502411-15502433 GCTGAAGTCCAGAGAGGAGAAGG - Intergenic
1078927485 11:15887641-15887663 GCTGAGACTCAAAGGGAAGGAGG + Intergenic
1079100316 11:17537533-17537555 GCTGAGGACCAGTGGAAAGGTGG - Intronic
1079245208 11:18747008-18747030 ACTGAGACCCAGGGAGAAGAAGG - Intronic
1079338247 11:19589967-19589989 GTTGAGGCACAGAGAGAGGCAGG - Intronic
1079407114 11:20156813-20156835 GGTGAGGCCGGGAGAGAAGGCGG + Intronic
1079535950 11:21515555-21515577 ACTGAGGCCCAAAGAGAAAATGG - Intronic
1080061359 11:27960156-27960178 ACTAAGGCCCAGAGAGAAAAAGG - Intergenic
1080427714 11:32171627-32171649 GCTGTGGCACAGAGAGGAAGGGG + Intergenic
1080459191 11:32438623-32438645 ACTGAGGCTCAGAGAGACTGCGG - Intergenic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1081573334 11:44304550-44304572 CCTGAGGCCAGGAGAGGAGGGGG - Intronic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081661810 11:44893035-44893057 GCTGAGGCCCAGAGAGGGACGGG - Intronic
1081666752 11:44921118-44921140 GATGAGGGACAGAGAGAACGTGG - Intronic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1081813789 11:45927674-45927696 ACTGAGGCCCAGAAAGGAGCAGG - Intronic
1082079131 11:47998470-47998492 GATGAGGCACAGAGAGGTGGAGG + Intronic
1083349438 11:62016995-62017017 GCTGAGGCAGAGAGAGAGAGAGG - Intergenic
1083443007 11:62689394-62689416 GCTATGGGCCAGAGAGGAGGAGG - Intronic
1083571611 11:63764513-63764535 GCTGAGATCCTGAGAGGAGGGGG + Exonic
1083713969 11:64565224-64565246 GCTGATGTCCAGCGTGAAGGAGG + Exonic
1083944041 11:65914123-65914145 ACTGAGGCCCAGAGAGAGAGTGG + Intergenic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1084411792 11:69009961-69009983 GCAGAAGCCCAGAGAGAGGGTGG + Intronic
1084554207 11:69866044-69866066 ACTGAGGCACAAAGAGGAGGAGG - Intergenic
1084700691 11:70784725-70784747 GCTGAGGTCCAGGGAGATGCTGG + Intronic
1084802229 11:71552454-71552476 GCTGATGCCAAGAAGGAAGGAGG - Intronic
1084870791 11:72097476-72097498 TCTGAGGCCAACAGAGAGGGTGG + Exonic
1084942495 11:72620438-72620460 ACTGAGGCCCAGAGAGTAGCAGG + Intronic
1084973334 11:72782972-72782994 ACTAAGGACCAGAGAGGAGGAGG - Intronic
1084974774 11:72790721-72790743 CCTGAGGCCAAGAGTGAAGATGG - Intronic
1085036704 11:73305302-73305324 CCTGGGGCCCAGAGAAAAGGGGG + Intergenic
1085038504 11:73313486-73313508 TTTGAGACCCAGAGAGGAGGTGG + Intronic
1085128406 11:74017641-74017663 ACCAAGGCCCAAAGAGAAGGTGG - Intronic
1085254954 11:75167149-75167171 GCTGCAGCTTAGAGAGAAGGTGG + Intronic
1085386817 11:76162408-76162430 GGAGAGGCCCAGGGAGATGGAGG - Intergenic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1085403419 11:76247820-76247842 GCTGGTTCCCAGAGAGCAGGAGG - Intergenic
1085449264 11:76622292-76622314 GCTGAGGCCCAGAGGTGGGGAGG + Intergenic
1085449550 11:76623697-76623719 AGTGAGGCCCAGAGACAAGCAGG + Intergenic
1085619930 11:78030418-78030440 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1085688153 11:78644436-78644458 GCGGAGGCCCATAGACATGGGGG - Intergenic
1085709583 11:78816942-78816964 GGTGAGGCCCAGAGAGGGGAAGG - Intronic
1086041545 11:82485612-82485634 ACTGAGGCCCAGAGAGGAGCAGG - Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1086945883 11:92843674-92843696 GCTGGGGTGAAGAGAGAAGGAGG - Intronic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1088813454 11:113406568-113406590 GCAGAGGCCCAGAGAGGCGCAGG - Intergenic
1088910968 11:114192341-114192363 GGTCAGCCCCAGATAGAAGGCGG + Intronic
1088986939 11:114917581-114917603 GCTGAGCAGCAGAGAGCAGGGGG - Intergenic
1089338682 11:117743253-117743275 GTGGAGGCCCAGGGAGGAGGAGG + Intronic
1089347032 11:117797181-117797203 GCTGAGGAGCAGAGAGAGCGGGG - Exonic
1089562718 11:119352956-119352978 ACGGAGGCCCAGAAAGAGGGAGG + Intergenic
1089685955 11:120147033-120147055 GGGGAGGCCCAGGGAGCAGGAGG + Intronic
1089694230 11:120206824-120206846 GCAAAGGCCCAGAGACAAAGGGG + Intergenic
1089850109 11:121488295-121488317 GCTAGGCCCAAGAGAGAAGGAGG - Intronic
1090047949 11:123352390-123352412 GCTGAGGCTCAGAGAGGTGAAGG - Intergenic
1090096115 11:123742946-123742968 TCTGAAGGCCAGAGAGCAGGAGG + Intergenic
1090101468 11:123801731-123801753 ACTGAGGCACAGATATAAGGTGG - Intergenic
1090332880 11:125945012-125945034 CCTGAACCCCAGTGAGAAGGGGG - Intergenic
1090588116 11:128236213-128236235 GATGAGGCCCAGAGGTAAGGGGG - Intergenic
1090876983 11:130798931-130798953 TGTGGGGCACAGAGAGAAGGTGG + Intergenic
1090917678 11:131180216-131180238 GCATAGGCCCAGTGACAAGGAGG + Intergenic
1091112176 11:132979759-132979781 GTTGAGGCCCTGGGAGAGGGAGG + Intronic
1091162440 11:133437343-133437365 GGTGATGCCCAGAGAGAAAGTGG - Intronic
1091319117 11:134637324-134637346 GCTGAGGCACAGAGAGGCTGTGG + Intergenic
1091388813 12:112607-112629 GCTGGGGCCCAGAGAAGAGGGGG - Intronic
1091391876 12:130843-130865 GCTGAGGAGCAGAGAGACTGGGG - Intronic
1091399970 12:175645-175667 GCAGAGGCCCTGGGAGGAGGGGG - Exonic
1091625679 12:2119153-2119175 TCTGAGGCCCAGAGAGCCTGAGG - Intronic
1091770838 12:3150289-3150311 GCTGATGCCCAGAGAGATTAGGG + Intronic
1092070990 12:5631327-5631349 GCTGAGACCCAGATGGCAGGAGG - Intronic
1092078152 12:5690514-5690536 GCCCAGGCCCAGAGCAAAGGAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1093475450 12:19549554-19549576 ACTCAGACACAGAGAGAAGGCGG - Intronic
1094219029 12:27973919-27973941 CAGGAGGCCCAGAGAGGAGGCGG + Intergenic
1094640668 12:32271979-32272001 ACTGAGGCCCAGAGAGATTAAGG - Intronic
1096002074 12:48138488-48138510 CCTGAGTCTCAGAGAGAAGGAGG - Intronic
1096515193 12:52151883-52151905 GCTGAGTCAGAAAGAGAAGGAGG + Intergenic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096675835 12:53225377-53225399 GCAGAGGCCCAGGGAGATGCTGG + Intronic
1096706615 12:53425874-53425896 GCAGGGGCCCAGAGAGCAGGCGG - Exonic
1096874115 12:54614013-54614035 GATGAGGTCCAGAGAGGTGGCGG - Intergenic
1097195787 12:57241875-57241897 GCAAAGGGCCCGAGAGAAGGGGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097588575 12:61545278-61545300 CAGGAGGCCGAGAGAGAAGGGGG + Intergenic
1097711680 12:62924199-62924221 ACTGAGGCCCAGAGTGGGGGGGG + Intronic
1098052475 12:66469126-66469148 GCTGAGGACCAGCTAGAGGGTGG + Intronic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1099792401 12:87352321-87352343 CCTGAGGCTCAGAGTAAAGGTGG + Intergenic
1099976598 12:89551974-89551996 GCTGTGGCCCAGAGAGGGTGCGG + Intergenic
1100285405 12:93161109-93161131 GCTAAGAGCCACAGAGAAGGTGG + Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101736021 12:107463940-107463962 ACAGAGGCCCAGAGAGATGAGGG - Intronic
1101960311 12:109244355-109244377 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1101963137 12:109264950-109264972 GCTGAGGCTCAGGGAGGAGAAGG - Intronic
1101963825 12:109268593-109268615 GCTGAGGCACAGAGAGGTGAAGG + Intergenic
1101969598 12:109303701-109303723 ACTGAGGCCCAGTGAGATGACGG - Intronic
1102028121 12:109725019-109725041 ACTGAGGCTCAGAGAGATTGAGG + Intronic
1102208153 12:111104872-111104894 GCTGTGGCCCTCAGAGAATGTGG + Intronic
1102403241 12:112649471-112649493 ACTGAGGCCCAAAGAGACGGTGG - Intronic
1102419931 12:112795483-112795505 TGTGAGGCACAGAAAGAAGGGGG - Intronic
1102466676 12:113134530-113134552 ACCAAGGCCCAGAGAGAAGCAGG + Intronic
1102535808 12:113580119-113580141 ACTGGGGCCCAGGGAGGAGGAGG - Intergenic
1102641146 12:114367649-114367671 GCAGAGGAGTAGAGAGAAGGTGG + Intronic
1102898574 12:116618252-116618274 ACTGAGGCTCAGAGAGATGTAGG - Intergenic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103053739 12:117802529-117802551 GTTGAGGCTCAGAGAGGAGGAGG - Intronic
1103220093 12:119236843-119236865 ACTGAGGCCAAGAGAGACTGAGG - Intergenic
1103578128 12:121893985-121894007 GCTGAGGCTTAGAGAGGAGAAGG + Intronic
1103721549 12:122978169-122978191 CCTGAGGCCCAGAGAGGGGAAGG - Intronic
1103722962 12:122984296-122984318 GGTGGGGCCAAGAGAGGAGGAGG + Exonic
1103963109 12:124621778-124621800 ACTGAGGCCCAGAGAGATTTGGG + Intergenic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104149710 12:126070874-126070896 GCTGAGGGCCAGAGGTAAAGAGG + Intergenic
1104195696 12:126535282-126535304 ACTGAGGCTCAGAGAGATAGAGG + Intergenic
1104727746 12:131088194-131088216 ACTGAGCCCCAGAGAGAGGGGGG + Intronic
1104787175 12:131457205-131457227 TCAGAGGCCAGGAGAGAAGGCGG - Intergenic
1104950621 12:132438252-132438274 GCAGAGCTCCAGAGAGAAGCTGG - Intergenic
1105771241 13:23614099-23614121 TCAGAGGCACAGAGAGGAGGGGG - Intronic
1106125896 13:26899781-26899803 GCTGAGGCCAGGAGAGGAGGTGG - Intergenic
1106436611 13:29729097-29729119 GCAGTGGCCCAGAGAAAAAGTGG - Intergenic
1107396676 13:40025251-40025273 GCTGATATCCAGAGAGAAGTGGG + Intergenic
1107452377 13:40521508-40521530 GCTGACGGCCAGAAAGAAGATGG + Intergenic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1107578724 13:41757589-41757611 GCTAAAGGGCAGAGAGAAGGAGG - Intronic
1107756688 13:43631312-43631334 GCTGAGGCCAAGAGTGAATTTGG - Intronic
1107789296 13:43985348-43985370 GCTGAAACCCAGAGAGATTGAGG + Intergenic
1108144693 13:47464076-47464098 GCTCAGGCCCAGAGAGATCACGG - Intergenic
1108800914 13:54093163-54093185 GCAGAGGCCCAAGGGGAAGGTGG + Intergenic
1110513662 13:76383021-76383043 TCTGAGGCCCAAAGAGATGATGG - Intergenic
1111639649 13:90951383-90951405 GATGATGCCCAGAGAGAAATGGG - Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1112284645 13:98093554-98093576 GCAGAGGAGCAGAAAGAAGGAGG - Intergenic
1113471325 13:110548781-110548803 GCTGAGGCCCAGAGAGCCTAGGG - Intronic
1113529636 13:111012933-111012955 GCTGAGGCCCAGACATCATGGGG - Intergenic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1113767308 13:112889362-112889384 CCTGGGGCCAAGAGAGAGGGAGG + Intergenic
1113942413 13:114025127-114025149 GCTGAGGCCCGGAGAAGGGGGGG - Intronic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1115598195 14:34929350-34929372 CCTGATGGACAGAGAGAAGGTGG + Intergenic
1116061959 14:39935056-39935078 GCTGAGGACCAGGGTGAAGGAGG - Intergenic
1116863938 14:50016291-50016313 ACTGAGGCCCTGGGAGAGGGTGG + Intergenic
1117073208 14:52074832-52074854 GATGGGGGCCAGGGAGAAGGAGG - Intergenic
1117209560 14:53481470-53481492 GCAGAGTGCCAGAGTGAAGGAGG - Intergenic
1117253441 14:53956148-53956170 TCTGAGGTCCAGAGAGAGTGAGG - Intronic
1117410845 14:55449608-55449630 ACTGAGACACAGAGAGAAGAAGG + Intronic
1117729949 14:58712468-58712490 TCTGAGACCCAGAGGGAAGGCGG - Intergenic
1117932163 14:60854937-60854959 GCTCTGTCCCAGAGAGACGGGGG + Intronic
1118164590 14:63323813-63323835 ACAGAATCCCAGAGAGAAGGAGG - Intergenic
1118320251 14:64748667-64748689 GCGGAAGCCCAGTGGGAAGGAGG + Exonic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118440099 14:65804429-65804451 TCAGAGGCCCAGAAAGGAGGAGG - Intergenic
1118776921 14:68979093-68979115 GCCGTTGCTCAGAGAGAAGGTGG - Exonic
1118893556 14:69928093-69928115 TCTGAGGCCCAGTGAGGAGAAGG + Intronic
1119682256 14:76601607-76601629 GCGGAGGGAGAGAGAGAAGGGGG + Intergenic
1120721296 14:87892186-87892208 GATGAGACACAGGGAGAAGGTGG + Intronic
1121014041 14:90537615-90537637 GCAAAGGCCCAGAGGGGAGGGGG - Exonic
1121116795 14:91349305-91349327 GCTGAGTTCCACAGATAAGGAGG + Intronic
1121322393 14:92999577-92999599 GCTGAGGCCCAGCAAGGAGGAGG - Intronic
1121329563 14:93041396-93041418 TCTGAGGCCCAGAGACCAGCAGG + Intronic
1121448421 14:93992866-93992888 GCTGAGGGCCTCAGAGGAGGTGG + Intergenic
1121467973 14:94128222-94128244 ACTGAGGCCCAGAGAGGACAGGG + Intronic
1121562292 14:94884576-94884598 TTGGAGGCCCAGAGAGGAGGGGG - Intergenic
1121629117 14:95409772-95409794 GCAGAGGCCCAGAGTCAAAGAGG - Intronic
1121710826 14:96038354-96038376 GCTGTGGCACAGGGAGATGGAGG - Intergenic
1121839246 14:97118881-97118903 CCTGTGGCCCAGAGAGGAGTGGG + Intergenic
1121883312 14:97519648-97519670 ACTGAGGCCCAGAGAACAGAAGG + Intergenic
1121898210 14:97668603-97668625 ACTGAGGCTCAGAGAGACGGGGG - Intergenic
1121950327 14:98166076-98166098 GCTGAGGCCCAGCTGCAAGGTGG + Intergenic
1122139158 14:99652130-99652152 ACTGAGGCTCTGAGAGATGGGGG + Intronic
1122286712 14:100656707-100656729 ACTGAGGCACACAGAGAAGGTGG + Intergenic
1122549090 14:102540245-102540267 ACTGAGGCCCAGAGGGATTGAGG + Intergenic
1122714277 14:103684582-103684604 GCAGAGGCTCAGGGAGGAGGAGG + Intronic
1122718684 14:103710027-103710049 GCTGAGGCCCGGGGAGACGGGGG + Intronic
1122794106 14:104197130-104197152 GGTGAGGCCCAGAGAGGGGAAGG - Intergenic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1122853977 14:104551432-104551454 GAGGAGGCCCAGAGAGAGGCAGG - Intronic
1122879062 14:104681919-104681941 GCTGAGGCGCTGTGGGAAGGAGG + Intergenic
1123066901 14:105623442-105623464 CCTGAGCCCCAGAGGGCAGGAGG + Intergenic
1123070921 14:105642153-105642175 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123090586 14:105740437-105740459 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123096216 14:105768187-105768209 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123794812 15:23760926-23760948 GATGGGGCGCAGAGAGATGGGGG + Intergenic
1124035291 15:26048851-26048873 CCTGGGGCCCAGGGAGAAGCGGG - Intergenic
1124080191 15:26486981-26487003 GCTGAGGTGCAGCGAGAAGATGG + Intergenic
1124578254 15:30928066-30928088 GCTGAGGCCAAGAACGGAGGTGG + Intronic
1124881225 15:33644640-33644662 TCTGAGGGCCAGAGGGGAGGTGG - Intronic
1124908940 15:33899072-33899094 GGTGGGGACCAGATAGAAGGTGG + Intronic
1125250357 15:37695123-37695145 TCTAAGGCCCTCAGAGAAGGAGG + Intergenic
1125523498 15:40361019-40361041 CCTGTGGGCCAGTGAGAAGGTGG - Intronic
1125604407 15:40931870-40931892 CCTGAGGCCCAGCTAGTAGGAGG - Intronic
1125766938 15:42142374-42142396 GCTGAGACCCAGGGAGCAGAGGG + Intronic
1126531623 15:49716810-49716832 GCTGAGGTTCAGAGAGATAGAGG - Intergenic
1126738275 15:51752607-51752629 GCAGAGGCCCAGAGAGGTGGAGG - Intronic
1126810814 15:52402075-52402097 ACTGAGGCCTAGACTGAAGGTGG + Intronic
1127752574 15:62060381-62060403 GCTGAGGCACAAGGAGAGGGAGG + Exonic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128055191 15:64694153-64694175 GATGAGGCCGAGAGTGGAGGAGG - Intronic
1128133488 15:65246106-65246128 GCCGAGGCCCTGAGAGAAGCAGG - Intronic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128254582 15:66187399-66187421 ACTGAGCCACAGAGAGCAGGTGG - Intronic
1128264474 15:66254459-66254481 ACTGAGACCCAAAGAGAAGAGGG + Intergenic
1128310773 15:66630713-66630735 GCTGGAGGCCAGTGAGAAGGTGG + Intronic
1128331723 15:66760579-66760601 CCTGAGGCCCAGAGAGGCTGAGG + Intronic
1128504598 15:68257729-68257751 GATGAAGGCCAGAGAAAAGGTGG - Intergenic
1128526120 15:68413612-68413634 GCTGAGGCCCAGAGAGGCACCGG - Intronic
1128541073 15:68533633-68533655 GCAGGGGCCTAGAGAGAATGAGG + Intergenic
1128557836 15:68643610-68643632 GTTGGGGCCCAGAGAGCTGGTGG + Intronic
1128619910 15:69140077-69140099 ACTGAGGCCCAGAGAGATCAAGG + Intergenic
1128636758 15:69307541-69307563 GATGAGGCCCTGAGGGTAGGAGG + Intronic
1129071135 15:72952552-72952574 ACCGAGGCCCAGAGAGTAGGAGG - Intergenic
1129153991 15:73706324-73706346 ACTGAGGTCCACAGAGAAGGGGG + Intronic
1129155510 15:73714846-73714868 GCTGAGACCCAGTAAGAAGCTGG + Intergenic
1129161274 15:73749298-73749320 ACTGAGGCCCAGAGAGCAATAGG - Intronic
1129163302 15:73759951-73759973 GCAGAGGCACAGAGAGCAAGAGG - Intergenic
1129165139 15:73772794-73772816 ACTGAGGCCCAGAGAGGAGCGGG + Intergenic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129258716 15:74350450-74350472 ACTGAGGCCCAGTGAGAAGAAGG - Intronic
1129268549 15:74407765-74407787 GCTGAGGCCCAGAGAGGACAGGG + Intergenic
1129382609 15:75177686-75177708 GCTGAGGCTCAGAGAGAGCAGGG - Intergenic
1129462888 15:75708696-75708718 ACTGAGGCTCAGAGAAAAGCAGG - Intronic
1129467697 15:75733103-75733125 GCTGATGCCCAGAGAAAGGAGGG + Intergenic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129600211 15:76994385-76994407 GCTGAGGCTCAGCGAGTTGGGGG + Intronic
1129607730 15:77032952-77032974 GGTGAGGCCCCGACAGACGGAGG + Exonic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129686864 15:77691288-77691310 ACTGAGGTCCAGAGAGGAGAAGG + Intronic
1129708591 15:77808706-77808728 ACTGAGGCTCAGAGAGATTGAGG - Intronic
1129721989 15:77882720-77882742 ACTGAGGCTCAGAGAAAAGCAGG + Intergenic
1129775459 15:78233616-78233638 GCGAAGGGGCAGAGAGAAGGAGG - Intronic
1129858701 15:78843570-78843592 GCAGAGGCCCAGAGAGGAAAGGG - Intronic
1129923279 15:79339165-79339187 GCTGAGGCAGAGAGAGAGAGAGG - Intronic
1130014561 15:80176566-80176588 GCTGAGGCTCAGAGAGGAAAAGG + Intronic
1130209419 15:81909612-81909634 ACTGAGGAGCAGAGAGGAGGGGG + Intergenic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1130557688 15:84934335-84934357 GCTCAGGCACATAGAGATGGGGG - Intronic
1130557749 15:84934882-84934904 CCTGAGACCCAGAGAGAAAAAGG - Intronic
1130696113 15:86133205-86133227 GCTGAGGCACAGAAAGAGAGAGG - Intergenic
1130912929 15:88283360-88283382 ACTGAGGTCCTGAGAGAAGCTGG - Intergenic
1131440339 15:92454891-92454913 GCTGCGACCCACAGAGACGGTGG + Intronic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1132225919 15:100141357-100141379 GCAGATGCCCAGAGAGGATGAGG - Intronic
1132347829 15:101119077-101119099 TCTTTTGCCCAGAGAGAAGGTGG - Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132648208 16:1008729-1008751 GTTGAGGTCCAGAGAGATGGGGG + Intergenic
1132711761 16:1271982-1272004 GCAGAGGCCCAGAGACCAGCTGG - Intergenic
1132711780 16:1272057-1272079 GCAGAGGCCCAGAGACCAGCTGG - Intergenic
1132714986 16:1285768-1285790 GATGTGGCCCTGAGAGCAGGTGG - Intergenic
1132771302 16:1564978-1565000 TCTGAGGCCCAGAGAGCCCGGGG + Intronic
1132990582 16:2790770-2790792 GCTGAGGGACACAGAGGAGGGGG + Intergenic
1132992623 16:2804842-2804864 GCAGAGGCCATGAGAGCAGGAGG - Intergenic
1133256289 16:4518452-4518474 GGTGAGGGGCAAAGAGAAGGTGG - Intronic
1133305473 16:4805463-4805485 GCTGAGGTCCAGAGAAACGGAGG - Intronic
1133488948 16:6248534-6248556 GATGAGGTCAAGAGAGAAGGGGG + Intronic
1133569188 16:7024927-7024949 ACTGAGGCCCAGAGAGGAACAGG + Intronic
1134220009 16:12346444-12346466 ACTGAGGCCCAGAGAGGTGGAGG + Intronic
1134509108 16:14832069-14832091 ACTGAGGCCCAGAGAGGAAAAGG - Intronic
1134696809 16:16230903-16230925 ACTGAGGCCCAGAGAGGAAAAGG - Intergenic
1134802468 16:17098285-17098307 TCTGAGGCCCAGAGAGATTAGGG + Intergenic
1134975028 16:18563793-18563815 ACTGAGGCCCAGAGAGGAAAAGG + Intergenic
1135123169 16:19784313-19784335 ACAGTGGCCCAGAGAGAAGATGG - Intronic
1135253673 16:20922951-20922973 TCTGAGGCCCAGAGAAGATGAGG + Intronic
1135400416 16:22162802-22162824 ACTGAGGCCCAGAGAACATGAGG - Intergenic
1135927094 16:26705022-26705044 GCTTAGGGCCAGAGGAAAGGTGG + Intergenic
1136026138 16:27470182-27470204 AATGAGGCCCAGAGAGAAGAGGG + Exonic
1136093260 16:27935749-27935771 ACTGAGGACCAGGGAGCAGGAGG - Intronic
1136109046 16:28053125-28053147 AGAGAGGCCCAGAGAGAAGGGGG + Intronic
1136143838 16:28303882-28303904 ACTGAGGCCCAGAGAGGGTGAGG + Intronic
1136381568 16:29898456-29898478 GCAGAGGACCAGAGAGAGAGAGG - Intronic
1136392316 16:29973590-29973612 GCTCGGGCTCAGAGCGAAGGCGG + Intergenic
1136651826 16:31679550-31679572 GCTGAGTACCAGAGAGTAGGAGG - Intergenic
1136671459 16:31862299-31862321 GCTGAGTACCAGAGAGCAGGAGG - Intergenic
1137019452 16:35409200-35409222 GCTTAGGCACAGAGAGAGGTGGG - Intergenic
1137222960 16:46473702-46473724 GCGGAGGGCCAGAGACAAGAGGG + Intergenic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1137505228 16:49048868-49048890 ACTGAGGCCCAGAGAGGCTGTGG + Intergenic
1137528608 16:49261412-49261434 CCTGAGCCCCAGAAAGGAGGTGG - Intergenic
1137596111 16:49725069-49725091 ACTGAGGCTCAGAGAGCTGGAGG - Intronic
1137613699 16:49835139-49835161 GCTGAGGGCCTCAGAGAAGAGGG - Intronic
1137726180 16:50658239-50658261 GCTGAGGCCCAGAGAGGGAAAGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1137995026 16:53201041-53201063 GCTGAGGCCCAGATAAATGATGG + Intronic
1138204331 16:55113881-55113903 GCCGAGGCTTAGAGAGAAGATGG - Intergenic
1138217317 16:55215530-55215552 ACTGAGCCCCAGAGAGGAGAAGG - Intergenic
1138289535 16:55835197-55835219 ACTAAGGCCCAGAGATGAGGAGG + Intergenic
1139445851 16:66998200-66998222 GCTTAGGCCTGGAGAGAAGGAGG + Intronic
1139459338 16:67109554-67109576 GCTGAGGCCCAGCAGGAGGGAGG - Intergenic
1139594375 16:67949564-67949586 CCTGAGGCCCCCAGAGCAGGTGG - Intronic
1139957445 16:70699894-70699916 GCTTAGCCCCAGACGGAAGGTGG - Intronic
1140457350 16:75113049-75113071 GCTGAGGCCTAGAGAAGAGCAGG - Intronic
1140766643 16:78165562-78165584 GCAGAGGCCCTGGGAGGAGGGGG + Intronic
1141315749 16:82961188-82961210 ACTGAGGCCCAGAGATGAAGTGG + Intronic
1141403951 16:83775170-83775192 GCTGAGGTCCAGAGAGATTTAGG - Intronic
1141422033 16:83923804-83923826 GCAAAGGCCCAGAGAGGAGAAGG + Exonic
1141422591 16:83926375-83926397 ACTGAGGCCCAGAGAGCTGAAGG + Exonic
1141526093 16:84612898-84612920 ACTGAGGCACAGAGGGAGGGAGG + Intronic
1141684281 16:85561581-85561603 ACTGAGGCCCAGAGAGAGCTGGG + Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142232222 16:88905345-88905367 GCTGAATCCCAGAGGGAACGAGG - Intronic
1142276301 16:89120644-89120666 CCTGTGACCCAGAGAGAAGATGG - Intronic
1142583459 17:955986-956008 ACTGAGGCTCAGGGAGGAGGCGG - Intronic
1142967974 17:3592679-3592701 CCTGAGGCCCAGAGACGAGGAGG - Intronic
1143002839 17:3805847-3805869 GCTGAGGCCCAGGGAGGTGAGGG + Intergenic
1143018700 17:3905104-3905126 ACAGAGGTCCAGAGAGAAAGAGG + Intronic
1143021775 17:3920480-3920502 GGTGAGTGCCAGAGAGGAGGTGG - Intergenic
1143029921 17:3962218-3962240 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1143082257 17:4390256-4390278 ACTGAGGTCCAGGGAGAGGGAGG + Intergenic
1143092536 17:4457595-4457617 GCTGGGGCCCAGGCAGATGGAGG + Intronic
1143121170 17:4607928-4607950 GCAGTGGCCCAGAGGGAGGGAGG - Exonic
1143274673 17:5701295-5701317 TCTGGGACCCAGAGAGATGGGGG + Intergenic
1143321731 17:6072725-6072747 CAGGAGGCCCAGGGAGAAGGTGG - Intronic
1143332326 17:6146896-6146918 GCTGAGGCCCCGAGGAAATGGGG - Intergenic
1143632421 17:8146765-8146787 GCTGGGGCAAAGAGAGAAAGAGG + Exonic
1143921782 17:10336082-10336104 ACTGAGGCCCAGAGAGGTGAAGG + Intronic
1144044302 17:11441047-11441069 GCTGATGCTCTGTGAGAAGGTGG - Intronic
1144429750 17:15180546-15180568 ACTGCAGCCCAGAGAGATGGAGG + Intergenic
1144450815 17:15377013-15377035 ACTGGGGCTCAGAAAGAAGGAGG - Intergenic
1144734545 17:17547689-17547711 GCTGTGCCCCAGACAGGAGGAGG - Intronic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1144763928 17:17722836-17722858 GGTGGGGCGTAGAGAGAAGGCGG - Intronic
1144773455 17:17772015-17772037 TCTGAGGCCCAGAGAGGACAAGG - Intronic
1144828125 17:18117944-18117966 ACTGAGGCCCAGAGAGGACAAGG + Intronic
1144875303 17:18394294-18394316 GCTTTGGCCCAAAGAGAATGGGG + Intergenic
1144948168 17:18980405-18980427 GCTGAGACCCAAGGAGAAGAGGG + Intronic
1145000419 17:19300949-19300971 GGGGAGGCGCAGTGAGAAGGTGG + Intronic
1145094853 17:20016631-20016653 GCTAAGGCCCAGCGAGAAATCGG - Intronic
1145156921 17:20550127-20550149 GCTTTGGCCCAAAGAGAATGGGG - Intergenic
1145786571 17:27597623-27597645 ACTGAGGTTCAGAGAGAGGGAGG + Intronic
1145877716 17:28332124-28332146 GGTGAGGCTCAGAGAGGTGGTGG - Exonic
1145996170 17:29106223-29106245 GCTGAGGGCCTGTGAGAAGGGGG + Intronic
1146157312 17:30535327-30535349 GCTGAGCCTCGGAGAGCAGGAGG - Intergenic
1146216773 17:30982721-30982743 GTTTAGGGCCAGAGAGAAGTGGG - Intronic
1146673538 17:34757920-34757942 ACTGAGGCCCCGAGAGGAGGTGG - Intergenic
1146786859 17:35728681-35728703 GCTGAGGCCCAGACACGAAGTGG - Intronic
1146896247 17:36544503-36544525 GCAGAGGCCCAGAGAGGACCTGG - Intergenic
1146956313 17:36938158-36938180 GATGAGGCCCAGAGAGAGAGAGG - Exonic
1146986391 17:37223714-37223736 GCTGAGGCACAGAGAGATTATGG - Intronic
1147319134 17:39635669-39635691 GATGAGTCCGAGAGAGATGGAGG + Exonic
1147374065 17:40013805-40013827 GCTGAGCCACAGAGCTAAGGCGG + Intergenic
1147553654 17:41462794-41462816 GCTGAGGCTTAGAGAGACGTGGG - Intronic
1147559024 17:41497676-41497698 GTTGAGTCCCAGAGAGAATGAGG + Intergenic
1147582774 17:41636451-41636473 ACTGAGGCCCAGAGAGGAAGAGG - Intergenic
1147741434 17:42672955-42672977 AATGAGACCCATAGAGAAGGTGG + Intronic
1147883811 17:43670917-43670939 GCTGAGGCCCAGAGAGGCCTAGG + Intergenic
1147945559 17:44078345-44078367 GGTGAAGCCCAGAGGGATGGGGG + Exonic
1147976817 17:44252777-44252799 ACTGAGACCCAGAGACAAGGAGG + Intronic
1148074205 17:44926317-44926339 GCTGAGACCCAGAAGAAAGGAGG - Intronic
1148381329 17:47200514-47200536 TCAGAGGTCCAGAGAGAAGGGGG - Intronic
1148438747 17:47701022-47701044 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1148480069 17:47954237-47954259 ACTGAGGCCCAGAGAGGTGGTGG - Intronic
1148581828 17:48749677-48749699 GCTGAGGCTTAGAGCGAAAGAGG - Intergenic
1150251836 17:63709853-63709875 TCTGGGGCACAGAAAGAAGGAGG + Intronic
1150972167 17:70041099-70041121 GCAGAGGTCCCTAGAGAAGGTGG + Intergenic
1150979724 17:70127522-70127544 GCTGAGGAGCAGAGAGAGAGAGG - Intronic
1151015767 17:70551035-70551057 GCTGAGGCCAGGGGAGAAGGTGG + Intergenic
1151441347 17:74131180-74131202 CCTGAGGCCCAGAGAGACTGTGG + Intergenic
1151535813 17:74738238-74738260 ACCGAGGCCCAGAGAGAGGCAGG - Intronic
1151557124 17:74852189-74852211 GATGAGGCCCACGGGGAAGGTGG + Exonic
1152072851 17:78142592-78142614 GATGAGGCCAAGAGGGAAAGAGG + Exonic
1152144855 17:78561980-78562002 GCTGAGGACAAAGGAGAAGGGGG + Exonic
1152233223 17:79125306-79125328 GCTGAGGCCCAAAGTGGTGGTGG - Intronic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152334579 17:79693222-79693244 GCTGAGTCCCAGAGCGACTGGGG + Intergenic
1152685334 17:81691032-81691054 GCTAAGCCACAAAGAGAAGGGGG - Intronic
1152687964 17:81703806-81703828 GCTGAGGCCAAGGGAGGAGCAGG - Intronic
1152799562 17:82324479-82324501 GCTGAGACTGAGAGGGAAGGAGG - Intronic
1152821629 17:82440520-82440542 GCTGACGGCCAGAGGGCAGGAGG - Intronic
1152895546 17:82909048-82909070 ACTGAGGCACAGAGAGAGGGAGG - Intronic
1153273640 18:3347635-3347657 ACTGAGGTCTAGAGAGAAGAGGG + Intergenic
1153493333 18:5671981-5672003 GCTGAGGCAGAGGGAGAAGAAGG - Intergenic
1153508841 18:5831296-5831318 TCTGAGGCCCAGAGTGGAAGTGG - Intergenic
1153627955 18:7039769-7039791 GATGAGGCCCACAGAGGAGGTGG + Intronic
1153702657 18:7711853-7711875 GCTGAGTCCCAGGGAGATGGGGG - Intronic
1153767291 18:8386375-8386397 ACTGAGGCAGAGAGAGAGGGAGG + Intronic
1154160242 18:11975976-11975998 CGTGAGGACCAGTGAGAAGGTGG - Intergenic
1156487970 18:37478601-37478623 GCACAGCCCCAGGGAGAAGGAGG + Intronic
1157314340 18:46575570-46575592 GAGGAGGCGCAGAGAGAAGGTGG + Intronic
1157745160 18:50128831-50128853 GAAGTGGCCCAGTGAGAAGGGGG + Intronic
1157871888 18:51237536-51237558 GCATAGGCTCAGTGAGAAGGTGG - Intergenic
1158157763 18:54444490-54444512 CCTGACGCCCAGAGACAGGGTGG - Intergenic
1158231815 18:55265032-55265054 GCTGAGGCTGAGACAGAGGGTGG - Intronic
1159891658 18:73958778-73958800 ACTGATGCCCAGAGTGATGGAGG - Intergenic
1160299589 18:77668196-77668218 GCTGAGACCCAGGGAGAAGGAGG - Intergenic
1160315510 18:77841682-77841704 GGAGAGGCCCAGAGAGAAGTGGG + Intergenic
1160535627 18:79589939-79589961 GCTGAGGCCCTGGGAGGAAGAGG - Intergenic
1160677498 19:399284-399306 ACTGAGGCTCAGAGAGGGGGAGG + Intergenic
1160798579 19:956797-956819 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1160896124 19:1402671-1402693 ACTGAGGCCCAGAGAGGTTGAGG + Intergenic
1161035848 19:2083890-2083912 GCTGAGCCTCAGGGAGAAAGCGG + Intronic
1161089508 19:2352955-2352977 GCTGGGGCCCACGGAGATGGAGG - Exonic
1161231685 19:3177816-3177838 ACTGAGGCCCAGAGAGCCCGAGG - Intronic
1161231702 19:3177894-3177916 ACTGAGGCCCAGAGAGCCCGAGG - Intronic
1161231711 19:3177933-3177955 ACTGAGGCCCAGAGAGCCCGAGG - Intronic
1161231744 19:3178089-3178111 ACTGAGGCCCAGAGAGCCCGAGG - Intronic
1161231753 19:3178128-3178150 ACTGAGGCCCAGAGAGCCCGAGG - Intronic
1161232278 19:3180240-3180262 ACTGAGGCCCAGAGAGGGGCCGG - Exonic
1161272550 19:3397962-3397984 ACTGAGGCACAGAGAGATGAAGG - Intronic
1161283298 19:3456957-3456979 ACTGAGGCCCAGAGAGACAAGGG + Intronic
1161302979 19:3551837-3551859 GCTGGAGCAGAGAGAGAAGGGGG - Intronic
1161331704 19:3691665-3691687 GGTGAGGCCAAGAGAGCAGGAGG - Intronic
1161342726 19:3751866-3751888 ACTGAGGCCCAGAGATAGGGAGG - Intronic
1161346862 19:3772443-3772465 ACTGAGGCCCAGAGAGGGAGAGG - Intergenic
1161357605 19:3827608-3827630 GCAGAAGCACAGAAAGAAGGAGG - Exonic
1161536692 19:4823703-4823725 GAGGAGACCCAGGGAGAAGGCGG + Intronic
1161646111 19:5454502-5454524 GCTGAGGCCCAGAGAGGCTAAGG + Intergenic
1161684806 19:5697489-5697511 GCTGAGGCAGAGGGAGGAGGGGG + Intronic
1161702112 19:5801360-5801382 ACTGAGGCTCAGAGAGGAGCAGG - Intergenic
1161829084 19:6589897-6589919 GGAGAGGCCCAGAGAAAGGGAGG - Intronic
1161993407 19:7698275-7698297 ACTGAGGCCCAGAGAGGAGCGGG + Intronic
1162550359 19:11355203-11355225 ACTGAGGCCCAGAGAGGGAGAGG + Intergenic
1162764374 19:12909490-12909512 GCAGAGGGACAGAGAGAAGCTGG - Intronic
1162940257 19:14005345-14005367 GCTTCCTCCCAGAGAGAAGGTGG + Intronic
1162943975 19:14031453-14031475 GCTGTGGACCCCAGAGAAGGTGG + Intergenic
1162949019 19:14059678-14059700 GCTGAGGTCCAGAGAGGGTGTGG - Intergenic
1163271916 19:16259630-16259652 GTTGAGGCCCAGAGAGGGGCAGG + Intergenic
1163390564 19:17027460-17027482 TCTGAGGCCCAGCGAGAGAGGGG - Intergenic
1164576394 19:29407797-29407819 ACTGAGGCCCAGTGAGAAGAAGG + Intergenic
1164685049 19:30161060-30161082 GCAGAGGCCCAGAGAGGTTGAGG + Intergenic
1164760136 19:30722465-30722487 ACTGAAGTGCAGAGAGAAGGAGG - Intergenic
1165060237 19:33201560-33201582 GCTGAGAACCAGAGAGAACTTGG + Intronic
1165102889 19:33449285-33449307 GCTCAGGCCCAGAAGAAAGGGGG - Intronic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1165433036 19:35783123-35783145 GCTGAGGAGGAGAGAGGAGGAGG + Intronic
1165495730 19:36151229-36151251 GCTGAGGCCCAGGGAGGAGTCGG - Intronic
1165792128 19:38499046-38499068 GCTGAGCCCCAGGAGGAAGGTGG + Intronic
1165934982 19:39383726-39383748 GCTGAGGCCCGGGGAGTTGGGGG + Exonic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166302651 19:41921215-41921237 TCAGAGACCCAGAGAGATGGAGG + Intronic
1166313465 19:41976032-41976054 GCTGAGTCTGAGGGAGAAGGAGG - Intronic
1166336388 19:42110575-42110597 GCTGGGGCCCAGAGGGAAAGTGG - Intronic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166562318 19:43741259-43741281 GCTGAGGGTGAGAGAGAAAGAGG + Intronic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1166943486 19:46383296-46383318 GCTGAGGGCGAGGGAGAAGCAGG - Intronic
1167260447 19:48455021-48455043 ACAGAGACCCAGAGAGAGGGGGG - Exonic
1167281801 19:48573548-48573570 GCTCAGGCCCAGAGAGTGGCAGG + Intronic
1167315663 19:48761521-48761543 ACAGAGACCCAGAGAGAAAGGGG + Intergenic
1167315748 19:48761899-48761921 ACAGAGACCCAGAGAGAGGGGGG + Intergenic
1167315843 19:48762293-48762315 ACATAGGCCCAGAGAGAGGGGGG + Intergenic
1167315862 19:48762356-48762378 ACAGAGGCCCAGAGAGAGAGGGG + Intergenic
1167348895 19:48963051-48963073 ACAGAGACCCAGAGAGAGGGGGG - Intergenic
1167368480 19:49066726-49066748 ACAGAGACCCAGAGAGAGGGGGG - Intergenic
1167368495 19:49066768-49066790 ACAGAGACCCAGAGAGAAGGGGG - Intergenic
1167427702 19:49437916-49437938 GCAGAGACCCAGAGAGAGAGGGG + Intronic
1167449433 19:49558199-49558221 ACTGAGGCCCAGAAAAAATGAGG + Intronic
1167460070 19:49620482-49620504 GCTGAGGCCTGGGGAGGAGGGGG + Intronic
1167463246 19:49637259-49637281 ACAGAGACCCAGAGAAAAGGGGG - Intronic
1167463305 19:49637658-49637680 ACAGAGACCCAGAGAAAAGGGGG - Intronic
1167631057 19:50626485-50626507 ACAGAGGCCCAGAGAGAGAGGGG + Intronic
1167631112 19:50626794-50626816 ACAGAGGCCCAGAGAGAGAGAGG + Intronic
1167698164 19:51026791-51026813 GCTGAGACACAGGGAGAAGAGGG - Intronic
1167707363 19:51089530-51089552 ACTGAGGCTGAGAGAGGAGGTGG + Intergenic
1167725799 19:51211921-51211943 CCTGGGGCCCAGGGAGATGGGGG - Intergenic
1167732343 19:51267686-51267708 GCTAAGGCCCAGAGAGGAGAAGG + Intronic
1167740582 19:51322773-51322795 GCAGAGACCCAGAGAGAGAGAGG - Intronic
1202665525 1_KI270708v1_random:115436-115458 GCCGAGGCGGAGAGAGAGGGAGG + Intergenic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925228890 2:2212906-2212928 GCTGTGGCCCTCAGAGAAGATGG - Intronic
925587945 2:5482225-5482247 GGTGAGTCTCAGAGAGAAAGAGG - Intergenic
925702793 2:6655605-6655627 ACTGAGGCCCAGATAGAGGTTGG + Intergenic
926222698 2:10946616-10946638 ACGGAGGCCCAGAGAGCAAGGGG + Intergenic
926412267 2:12616650-12616672 GGTCAGGCACAGAGAGAATGAGG + Intergenic
927108353 2:19846494-19846516 GCAGAGGCTCAGAGAGGAGAAGG + Intergenic
927307518 2:21590540-21590562 TCTGAGGCCCAGAGAGAAAGGGG + Intergenic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
928217596 2:29375235-29375257 GCTGAGGGTCAGTGAGAAGGTGG - Intronic
928368366 2:30721151-30721173 TCTGAGGCCCCGAGAAGAGGTGG - Intergenic
929061029 2:37925059-37925081 GCGGAGGCCCAGAGCCCAGGCGG + Intronic
929433296 2:41907137-41907159 ACTGAGGCCCAAACAGAAGTGGG - Intergenic
929489992 2:42387646-42387668 GCTGGGCCCCAGAAAGAAGGTGG - Intronic
929547547 2:42865571-42865593 ACTGAGGCCCAGAGAGAACGTGG + Intergenic
929563346 2:42969390-42969412 GCCAAGGCCCAGAGAGAGGAGGG + Intergenic
929814775 2:45221871-45221893 ACTGAGGCCCAGAGAAGAGGGGG - Intergenic
930121636 2:47765562-47765584 GCTGAAGCTCAGAAAAAAGGAGG + Intronic
930137784 2:47919876-47919898 GCTGAGGCAAAAAGAGAAAGAGG - Intergenic
930321821 2:49864612-49864634 GCTGATGCCCAGGCAGAAGTGGG + Intergenic
930323374 2:49882706-49882728 GCTGTGTCCCAGAGAGATGGGGG - Intergenic
930358095 2:50346306-50346328 CCTGAGCACCAGAGAGAAGAGGG - Intronic
930731188 2:54729553-54729575 GCTGAGGCACAGAGAGGTTGAGG + Intronic
930805880 2:55489784-55489806 GCTAACGCCCAGAGAGAAAAGGG - Intergenic
931018043 2:58008942-58008964 GCTGCATCCCACAGAGAAGGAGG + Intronic
931040082 2:58287595-58287617 ACTGAGCCCCAGAGAGAAGCTGG - Intergenic
932401376 2:71483096-71483118 GCACAGCCACAGAGAGAAGGTGG - Intronic
932511768 2:72300142-72300164 GCTCAGTCCCAGGGAGATGGGGG + Intronic
932612521 2:73210358-73210380 GCTGAGGCTCAAAGAGAGAGAGG - Intronic
932817888 2:74876287-74876309 GATGAGCCCCAGCGAGGAGGAGG - Intronic
933260726 2:80128426-80128448 GCTGTGGCCCAGAGAGGATAGGG - Intronic
933900510 2:86846417-86846439 GCCGAGGCTCAGAGAGACCGGGG + Intronic
933932230 2:87164829-87164851 CCTGAGGCTAAAAGAGAAGGCGG - Intergenic
933939457 2:87233280-87233302 GCTGAGGCACAGAGAAAGGAAGG - Intergenic
934028152 2:88017694-88017716 GCTGAGGCTCAGAGAGATTAAGG - Intergenic
934538426 2:95155928-95155950 CCTGAAGCTCAGAGAGAAGAGGG + Intronic
934652005 2:96098173-96098195 GCCCAGGCCCAGAGAGGAGGAGG + Intergenic
934883115 2:98000483-98000505 GCAGAGAACCAGGGAGAAGGGGG - Intergenic
934990208 2:98915203-98915225 ACTCAGGCTCAGAGACAAGGGGG + Intronic
935067104 2:99658747-99658769 GGTGAGGCCAAGACAGAATGGGG - Intronic
935651069 2:105382476-105382498 GCTGAGGCCTAGAGAGGATGAGG - Intronic
935780039 2:106502808-106502830 GCCGAGGCTCAGAGAGACCGGGG - Intergenic
936066364 2:109335435-109335457 CCTGAGGGGCAGAGAGGAGGTGG - Intronic
936353678 2:111732493-111732515 GCTGAGGCACAGAGAAAGGAAGG + Intergenic
936360883 2:111800604-111800626 CCTGAGGCTAAAAGAGAAGGCGG + Intronic
936736267 2:115446814-115446836 GCTCAGGCACAGAAGGAAGGGGG - Intronic
937046843 2:118856195-118856217 ACTGAGGCCCAGAGAGCAGCGGG - Intergenic
937204016 2:120224207-120224229 ACTGAGGCCCAGAGAGAAAGAGG - Intergenic
937284463 2:120741447-120741469 GGAGAGACCCAGAGAGAAGAGGG - Intronic
937421541 2:121760391-121760413 GCTGAAGCACAGAGAGAGGTAGG + Intronic
937829951 2:126408762-126408784 GCTGAGCCTCACAGAGAAGTTGG + Intergenic
937849348 2:126619128-126619150 GCTGAGGCTCAGAGAGGTGCTGG - Intergenic
937983016 2:127625884-127625906 GCTGAGGCCCAGAGGCAGGCAGG - Intronic
938115789 2:128602260-128602282 GCTGAGGCCCAGGGAGCCGAGGG + Intergenic
938986559 2:136581960-136581982 GGTGAGGGACAGAGAGAAGTTGG - Intergenic
938992369 2:136642798-136642820 GCTGAGGGAGAGAGAGAACGTGG - Intergenic
939141747 2:138362286-138362308 GCTGAGGCCCAGATAGCTGAAGG + Intergenic
941013859 2:160332479-160332501 GCTGAATCCCAGAGAGAATGAGG - Intronic
941072593 2:160971150-160971172 ACTGAGGTCCAGAGAGAACAAGG - Intergenic
941164343 2:162069350-162069372 ACTGAGGCCCATGGAGAATGTGG - Intronic
941820532 2:169840245-169840267 GCTCAGGCCCAGAGGGAGGTGGG - Intronic
942463945 2:176188917-176188939 GCCGTTGCCCAGAGGGAAGGCGG - Exonic
943084958 2:183300423-183300445 GCTCTGTCCCAGAGAGATGGGGG + Intergenic
943233774 2:185291626-185291648 GCTGAGGCAGAGAGAGAGAGGGG - Intergenic
944727631 2:202486946-202486968 CCTGAGCCCCAGGGAGATGGAGG + Intronic
945053708 2:205849677-205849699 GCTTAGGAACACAGAGAAGGGGG + Intergenic
945302548 2:208227851-208227873 GCTGAGGCCCGGCGAGAATTTGG + Intergenic
945868623 2:215203362-215203384 GCTGAAGGTCAGAGAGAAGTAGG - Intergenic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946167672 2:217875248-217875270 GGTCAGGCCCACTGAGAAGGTGG + Intronic
946196547 2:218035666-218035688 ACTGTGGCCCTGAGAGCAGGTGG - Intronic
946269361 2:218577607-218577629 CCTGATGCCCACAGAGAAGATGG - Intronic
946310143 2:218878778-218878800 ACTGAGGCCCAGAAAGAATTAGG - Intergenic
946403332 2:219480318-219480340 GCTGAGGCCTTGAGAGAATGGGG - Intronic
946413393 2:219526867-219526889 GCTAAGGCAGAGAGAGAGGGAGG + Intronic
946709975 2:222495656-222495678 TCTGAGCCACAGGGAGAAGGTGG - Intronic
947158288 2:227185934-227185956 GGTGATGCCCAGAGAGAGGCAGG - Intronic
947384874 2:229580959-229580981 TCTGAGGCTCAGACAGAATGGGG + Intronic
947731011 2:232431653-232431675 ACTGAGGCCCAGAGACAAGAAGG - Intergenic
948189238 2:236045493-236045515 GCTGAGGCCCGGAGAGCAAGAGG + Intronic
948369959 2:237482603-237482625 GCTGGAGCCCAGAGAGCAAGCGG + Intergenic
948679040 2:239619753-239619775 ACTGAGCCCCAGGGAGGAGGTGG - Intergenic
948726615 2:239938162-239938184 ACTGAGGCCCTGACAGATGGGGG - Intronic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
949072005 2:242030986-242031008 ACTGAGGCCCAGGGTGAAGTGGG - Intergenic
1168792474 20:588971-588993 ACTGAGGCACAGAGAGGAGAAGG + Intergenic
1168831335 20:846783-846805 ACTGAGGCCCAGAGGGAAACTGG - Intronic
1168850855 20:976069-976091 ACTGAGGCCCACAGAGACGAGGG - Intronic
1168858729 20:1029402-1029424 ACTCAGGCCCAGAGAGGAAGAGG - Intergenic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1169197276 20:3690028-3690050 GCTGAGGCCCAGCGACCAAGGGG - Exonic
1170004588 20:11651967-11651989 GATGAAGCCCAGAGAGCATGAGG - Intergenic
1171096765 20:22339851-22339873 GCCGATGTCCAGAGAGAAAGTGG + Intergenic
1171242658 20:23584628-23584650 GCTCCAGCCCAGAGAGCAGGGGG - Intergenic
1171266497 20:23775940-23775962 GCTGCGAGCCAGAGAGCAGGTGG - Intergenic
1171419450 20:25008116-25008138 GCTTAGGTCCAGACAGTAGGAGG - Intronic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172184275 20:33021561-33021583 GCTGGGGCTCAGAGAGAAAAAGG - Intronic
1172197408 20:33101401-33101423 ACTGAGGCTCAGAGTGAAGTTGG - Intronic
1172205007 20:33157053-33157075 AGAGAGGCCCAGAGAGAGGGTGG - Intergenic
1172434834 20:34921483-34921505 GCTGGGGCCCAGGGACAATGTGG + Intronic
1172502363 20:35436481-35436503 ACTGAGGCCCTGAGAGGGGGAGG + Intronic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1172768361 20:37363040-37363062 GCTGAGGCCCAAAGGCTAGGCGG - Intronic
1172779811 20:37429631-37429653 CCTGAAGCCAAGAGACAAGGAGG - Intergenic
1172830200 20:37827455-37827477 GTTGAGACCCAGAGAATAGGTGG + Intronic
1172837083 20:37880047-37880069 ACTGAGGCTCAGAGAGAACTAGG + Intergenic
1172842736 20:37911758-37911780 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1173070550 20:39760500-39760522 ACTGAGGCTCAGAGAGAATAGGG - Intergenic
1173647894 20:44644946-44644968 ACTGAGGCTCAGAGAGTGGGAGG + Intronic
1173721356 20:45260859-45260881 ACTGAGGCCCAGAGAAAGGAAGG - Intergenic
1173863607 20:46300075-46300097 ACTGAGGCCCAGGGAGAGGCTGG - Intronic
1173893471 20:46531504-46531526 ACTGAGGCTCAGAGAGGAGAGGG + Intergenic
1174202523 20:48816996-48817018 ACTGAGGCCCAGAGAGGGTGAGG - Intronic
1174423749 20:50417497-50417519 ACTGAGGCACAGAGAGAGGGTGG + Intergenic
1174524267 20:51158823-51158845 ACTGAGGCTCAGAGAGGAAGTGG - Intergenic
1174670917 20:52306919-52306941 GATGAGGGCCAAAGAGAAGGAGG + Intergenic
1174859698 20:54079238-54079260 TCTGAGGTTCAGAGAGAAGTAGG - Intergenic
1175100992 20:56578724-56578746 ACTGAGGCTCAGAGAAAAGCAGG + Intergenic
1175225152 20:57440243-57440265 GCTGAGGCCCAAAGATGAGAGGG - Intergenic
1175780158 20:61677010-61677032 GCTGAGGACCAGACAGAGAGAGG + Intronic
1175828493 20:61949966-61949988 CCAGAGGCCCACAGGGAAGGCGG - Intergenic
1176054016 20:63134955-63134977 GGCAGGGCCCAGAGAGAAGGCGG + Intergenic
1176054239 20:63135467-63135489 GGCAGGGCCCAGAGAGAAGGCGG + Intergenic
1176372950 21:6073563-6073585 GCACAGGCCCAGAGAGGAAGTGG + Intergenic
1176521848 21:7830141-7830163 GCTGTGGACCAGACAGGAGGGGG + Intergenic
1178383869 21:32133991-32134013 GCTGAGGCCCAGTCTGAAGGTGG - Intergenic
1178406922 21:32332012-32332034 GCAGAGGCCCAGTGAGCAGCTGG + Intronic
1178422930 21:32456537-32456559 GCTGGGCCCCTGAGAGAATGGGG + Intronic
1178655868 21:34460153-34460175 GCTGTGGACCAGACAGGAGGGGG + Intergenic
1178896335 21:36561711-36561733 GCTGAGACTCAGGGAGAGGGAGG - Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179614795 21:42575475-42575497 GCAGGAGCCCAGAGAAAAGGGGG - Intronic
1179750527 21:43464680-43464702 GCACAGGCCCAGAGAGGAAGTGG - Intergenic
1180154712 21:45972367-45972389 GCTGGGTCCCAGAGAGACGGGGG - Intergenic
1180618262 22:17143035-17143057 CCTGAGGGCCAGAGAGGAGACGG + Intronic
1181063281 22:20292166-20292188 ACTGAAGCTCAGAGAGGAGGAGG - Intergenic
1181088633 22:20457071-20457093 GCTGAGACCCAGGAAGTAGGGGG + Intronic
1181103100 22:20554626-20554648 GCTGAGGCCTTGAGGGCAGGTGG - Intronic
1181730614 22:24843618-24843640 ACTGAGGTCCAGAGAGGAGACGG + Intronic
1182024592 22:27108133-27108155 GCTGAGGCCCAGAGAGGGAAGGG - Intergenic
1182076454 22:27498735-27498757 GCTGAGGCGCAGAGAGGAAAAGG - Intergenic
1182097915 22:27638402-27638424 GCTGAGGCCCAGAGAGGGGTTGG + Intergenic
1182120208 22:27781544-27781566 ACTGAGGCCCAGAGAGGAACTGG + Intronic
1182447259 22:30397137-30397159 TCTGAGCCCCAGGCAGAAGGAGG + Exonic
1182475227 22:30573517-30573539 CCTGAGGCCCAGAGAGGGTGAGG - Intronic
1182504584 22:30772688-30772710 GCTGAGGCCAAGAGAGGCAGAGG - Intronic
1182557266 22:31136007-31136029 GCTGAGGCCCAGAGAGAGAGGGG + Intronic
1183074639 22:35419232-35419254 ACTGAGACCCAGAGGGAGGGAGG - Intronic
1183143014 22:35961903-35961925 GTTGGGGACCAGAGAGGAGGAGG - Intronic
1183210707 22:36449623-36449645 GCTGAGGCCCAGAGATGGGAAGG - Intergenic
1183280410 22:36929244-36929266 GCTGAGGCTCACAGAGGAGACGG + Intronic
1183314543 22:37129613-37129635 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1183347358 22:37315223-37315245 GCTGAGGACCAGAGAGGGGAAGG - Exonic
1183362774 22:37391259-37391281 GCTGTGGTCCAGGCAGAAGGTGG - Intronic
1183381940 22:37494483-37494505 ACTGAGGCCCAGAGACCAAGAGG + Intronic
1183394033 22:37561292-37561314 ACTGAGGCTTAGAGAGTAGGGGG + Intronic
1183563868 22:38598772-38598794 AATGAGGCACAGAGAGAAGCTGG + Intronic
1183600249 22:38835783-38835805 GCTGAGGCTCAGAGAGGCTGAGG - Intronic
1183651143 22:39153627-39153649 GCTGTGGTCCAGAGAAAAGACGG - Intergenic
1183897810 22:40983181-40983203 GCTGAGAAGCAGAGAGATGGGGG + Intergenic
1183985010 22:41564766-41564788 GGTGAGGTCCAGAGAGGAGCAGG + Intronic
1184259292 22:43305531-43305553 GCAGAGGCCCAGAGGGCATGAGG + Intronic
1184297219 22:43532424-43532446 ACTGAGGCCCAGGGAGGCGGAGG + Intronic
1184355306 22:43975609-43975631 GCACCGGCCCAGAGAGAAGGTGG - Intronic
1184604091 22:45562355-45562377 ACTGAGGCTCAGAGAGAATGTGG - Intronic
1184661020 22:45965531-45965553 ACTGAGGCCCAGAGAAGGGGAGG + Intronic
1184693769 22:46128928-46128950 GCAGAGGCCCAGAGACAGTGGGG - Intergenic
1185231515 22:49686761-49686783 GGTGAGGACCACAGAGCAGGTGG + Intergenic
1185311772 22:50160067-50160089 GCTGAGGAGCAGAGAGTGGGAGG + Intronic
1185317521 22:50185433-50185455 GCCGATCCCCAGAGGGAAGGGGG + Intergenic
949897256 3:8777173-8777195 ACTGAGGCCCAGGGAGATGTGGG - Intronic
950013767 3:9742194-9742216 GGAGAGGAACAGAGAGAAGGTGG - Intronic
950076816 3:10193240-10193262 GCTGAGTCCCAGATACAAGGAGG - Intronic
950106621 3:10392785-10392807 ACTGAGGTCCAGAGAGGAGAGGG - Intronic
950128705 3:10527353-10527375 ACTGAGGCACAGAGAGATGGAGG + Intronic
950195664 3:11007511-11007533 GCTGAGGCACAGAGAGGGGAAGG + Intronic
950212068 3:11131023-11131045 GTTGAGACCCAGAGGGATGGTGG - Intergenic
950229378 3:11263029-11263051 ACTGAGGCCCAGAGAGATTGAGG + Exonic
950361498 3:12452599-12452621 ACTGAAGCCCAGAGAGAAAAGGG + Intergenic
950362509 3:12459628-12459650 ACTGAGGGCCAGAGAGGAGAAGG - Intergenic
950364841 3:12475512-12475534 ACTGAGGTCTAGAGAGAAGAAGG - Intergenic
950405109 3:12799301-12799323 TCTGAGGCCCAGAGAAAAGGAGG + Intronic
950434758 3:12972679-12972701 ACTGAGGTCCAGAGAGGTGGAGG + Intronic
950451526 3:13068178-13068200 TCTGAGGCCCAGGGAGGATGTGG + Intronic
950459610 3:13113381-13113403 GCTGAGGCCCAGAGAGGTCAAGG - Intergenic
950620923 3:14204675-14204697 GCTGAGAACCACAGAGAGGGAGG - Intergenic
950653700 3:14423672-14423694 ACTGAGGCCCAGGCAGAAGATGG - Intronic
950864621 3:16179263-16179285 ACTGAGGCACAGAAAGATGGAGG + Intronic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952503761 3:33989115-33989137 GCTCAGGCCCAGGGAGATGAGGG + Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
952961820 3:38596856-38596878 ACTGAGGCCCAGAGACAGGAGGG - Intronic
953234655 3:41095619-41095641 TCTGAGGGCTACAGAGAAGGTGG + Intergenic
953771559 3:45781812-45781834 GCTGAGGTCCAGAGAAGAGAAGG + Intronic
953788373 3:45928392-45928414 CCTGAGGCCCAGGGACAAAGTGG - Intronic
953876417 3:46669343-46669365 GGTGAGGCCTAGTGAGAGGGTGG + Exonic
954097756 3:48343539-48343561 GCCAGGGCCCAGAGGGAAGGTGG + Intergenic
954212771 3:49107633-49107655 GCTGAGGACAGGAGAGGAGGAGG + Intergenic
954330729 3:49888831-49888853 ATTGAGGCCCAGAGAGGAGAAGG + Intronic
954628555 3:52036026-52036048 GGTCAGGCCCAGAAGGAAGGTGG - Intergenic
954930943 3:54280803-54280825 GCTGAGACCCAAAAAGGAGGAGG - Intronic
955203691 3:56876111-56876133 GCAGAGGCCCAGGGACAAGATGG + Intronic
956142828 3:66162897-66162919 GCTTAGGCTCAGAGAGATAGAGG + Intronic
956370673 3:68556947-68556969 TCTGAGGGCTAGAAAGAAGGGGG + Intergenic
956447511 3:69340018-69340040 GCTGGGGCCCAGGGAGTAAGAGG - Intronic
956594467 3:70950548-70950570 GCTGAGGACCAAAGAGATGAAGG + Intergenic
956762918 3:72459445-72459467 GCTGTGGGCCAGAGAGGAGGGGG + Intergenic
958678624 3:97296807-97296829 CCTGAACCCCAGAGAAAAGGTGG - Intronic
958737056 3:98021350-98021372 GCTGAGTCACAGATAGAAGGTGG + Intronic
959418342 3:106104204-106104226 GCTCAGGCCCAGAGAGATCTGGG + Intergenic
959555502 3:107712665-107712687 GCAGAGGCCGGGAGAGAGGGAGG - Intronic
959624673 3:108436499-108436521 GTTGAGGCCCACAGTGAAAGAGG - Intronic
960365531 3:116767010-116767032 GGTGAGGCCCAGGAAGCAGGAGG - Intronic
960713751 3:120556249-120556271 GAAGAGACCCAGAGATAAGGAGG + Intergenic
960940148 3:122928090-122928112 GGAGAGGCCCAGAGAGACTGGGG - Intronic
961465467 3:127078490-127078512 ACTAAGGCCCAGAGAGGAGAAGG + Intergenic
961482951 3:127195780-127195802 GATGAGGCACAGAGAGACGGTGG - Intronic
961518686 3:127454785-127454807 ACTGAGGCCCAGAGAGCCGAAGG - Intergenic
961646235 3:128394167-128394189 GCTGAGGCCCAGGGTGAGCGTGG - Intronic
961749240 3:129085870-129085892 GCAGAGGCCCAGGCAGGAGGTGG + Intergenic
961770997 3:129249830-129249852 GCTGAGGCCCAGTGAGGGGCAGG + Intronic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
961820290 3:129572453-129572475 ACTGAGGCTCAGAGAGGAGAAGG + Intronic
961821735 3:129578760-129578782 GGTGAGGCCCAGAGACAGGGAGG - Intronic
961868819 3:129973976-129973998 ACTGAGGCCCAGAGAAACGGAGG + Intergenic
961959867 3:130843629-130843651 TGTCAGGCCCAGAGAGAATGAGG + Intergenic
962257373 3:133881648-133881670 TCTGAGGCCTAGAAAGAAGGAGG + Intronic
962353919 3:134677667-134677689 GCAGCAGCCCAGGGAGAAGGAGG - Intronic
962606428 3:137036188-137036210 ACTGAGGCCCAGAGAGATGGGGG + Intergenic
962752613 3:138444922-138444944 GCTCAGGCCCTGGAAGAAGGTGG - Intronic
962835670 3:139186362-139186384 CCTGAGGCACAGACAGGAGGGGG - Intronic
963294213 3:143527750-143527772 GCTGAGGCACTGAGGGAAGAAGG - Intronic
963461219 3:145617137-145617159 GCTCAGGCCCAGAGACATCGAGG + Intergenic
964848016 3:161064770-161064792 ACTGAGGCCTAGGGAGAGGGTGG - Intronic
965655004 3:170974883-170974905 GCTCTGTCCCAGAGAGATGGAGG + Intergenic
966910351 3:184556146-184556168 GCTGAGGCCTGGAGAATAGGAGG - Intronic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
966954697 3:184863583-184863605 GCAGGAGCCTAGAGAGAAGGAGG + Intronic
967231107 3:187338272-187338294 TCTGAGCCCAAGAGAGAAGAAGG + Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967829874 3:193909714-193909736 GCTGAGGCCCACAGAGGAGTGGG - Intergenic
967852498 3:194093063-194093085 GCTGCTGCCCAGAGAGAAAGAGG + Intergenic
967973330 3:195015347-195015369 GCTGAGGCCCAGGGCCAAGGGGG - Intergenic
968282106 3:197484946-197484968 GCTGAGGGCCAGAGAGCAGAGGG - Intergenic
968871829 4:3246319-3246341 ACAGAAGCCCAGAGAGGAGGTGG - Intronic
969151921 4:5176937-5176959 GTTGAGGCCCAGAGAGTCTGAGG - Intronic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969180224 4:5435000-5435022 GCTGAGGCCCACAGAGATTAGGG - Intronic
969199589 4:5592265-5592287 GCTGGCTCCCAGAGAGAAGGGGG + Intronic
969268418 4:6081349-6081371 ACAGAGGCTCAGAGAGAATGGGG + Intronic
969305108 4:6321824-6321846 AATGAGGGCCACAGAGAAGGTGG - Exonic
969311718 4:6356818-6356840 TCTGAGGCTCAGGGAGCAGGAGG + Intronic
969311757 4:6356997-6357019 TCTGAGGCTCAGGGAGCAGGAGG + Intronic
969311792 4:6357176-6357198 TCTGAGGCTCAGGGAGCAGGAGG + Intronic
969429884 4:7147891-7147913 GCTCAGGCCCAGAGGCAAGAGGG - Intergenic
969457586 4:7308931-7308953 GGAGAGGGCCAGAGAGCAGGAGG - Intronic
969498029 4:7537198-7537220 ACTGAGGCCCAGAGAGGAAATGG - Intronic
969498406 4:7539331-7539353 GCTGGGGCCTGGAGAGCAGGTGG - Intronic
969502001 4:7558981-7559003 GCTGAGGCCCAGATAGGGGCAGG - Intronic
969506372 4:7590626-7590648 ACTGAGGCCCAGAGACAAAGGGG + Intronic
969615720 4:8251620-8251642 GCTGAGGCCCAAAGAGGGGAAGG + Intergenic
969617560 4:8262515-8262537 GCTGGGGTCGAGAGAGGAGGTGG - Intergenic
969642404 4:8406687-8406709 GCTGAGGCAGAGAGAGAGAGAGG + Intronic
969672697 4:8598500-8598522 GCAGGGGGCCAGGGAGAAGGGGG - Intronic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
972814405 4:42628399-42628421 GCTGGAGCACAGACAGAAGGCGG + Intronic
972872695 4:43319846-43319868 TCTGAGGCAGAGAGAGATGGGGG + Intergenic
973041559 4:45475783-45475805 GCTCAGGCACAGAGGGAGGGGGG + Intergenic
975178825 4:71319802-71319824 GCTGAGTCAGAGGGAGAAGGAGG + Intronic
975407645 4:74009747-74009769 AGGGAGGCCCAAAGAGAAGGAGG - Intergenic
976398552 4:84583066-84583088 GCAGAGGCCCAGGTAGGAGGAGG - Exonic
978497661 4:109377541-109377563 GCTGAAGCCCAGTGAGTCGGTGG + Intergenic
979115312 4:116815616-116815638 GCTCTGTCCCAGAGAGATGGGGG - Intergenic
979122855 4:116926042-116926064 GCCGAGGACCAGGGGGAAGGAGG - Intergenic
979305990 4:119144105-119144127 GATGGGGCCTAGAGAGAAGTGGG - Intronic
980100282 4:128535488-128535510 GCTCAGTCCCAGGGAGATGGGGG + Intergenic
980880009 4:138700502-138700524 ACTGAGGCCCAGAGAGGTGGTGG - Intergenic
982205567 4:152995166-152995188 GCTGAGGCCCAGAGGCTGGGTGG + Intergenic
982409661 4:155060148-155060170 ACAGAGGCAGAGAGAGAAGGAGG - Intergenic
983168880 4:164513230-164513252 GCTGAGGCCCAGGGAGCAGGAGG + Intergenic
983793106 4:171823322-171823344 GCTGATGCCCTGAGAGATTGAGG + Intronic
983817434 4:172149548-172149570 ACAGAGGCCCAGAGATAAGCAGG - Intronic
984441001 4:179770541-179770563 GAAGAGGCCCAGAGAGGAGCTGG + Intergenic
985321477 4:188716537-188716559 ACTGAGGCCCAGAGAGGACAGGG + Intergenic
985471254 5:48270-48292 GCTGGGGAGCAGAGTGAAGGAGG + Intergenic
985471291 5:48499-48521 GCTGAGGGACAGAGTGAAGGAGG + Intergenic
985471312 5:48613-48635 CCTGGGGCACAGAGTGAAGGAGG + Intergenic
985508114 5:296321-296343 GCAGAGGCCCAGGGTGAAGTGGG - Intronic
985544467 5:502249-502271 GCTGGGTCCCAGAGAGGAAGGGG - Intronic
985739922 5:1609348-1609370 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
986132454 5:4943571-4943593 TGTGAGGGCCACAGAGAAGGTGG + Intergenic
986140684 5:5026720-5026742 GCTCAGGCCCAGAGAGATCCAGG - Intergenic
986315902 5:6586174-6586196 GCTGAGTGCCAGGGAGGAGGAGG - Intergenic
988564620 5:32311718-32311740 GCAGAGGCCCATGGACAAGGGGG - Intronic
988860553 5:35273477-35273499 TGTGAGGCCCAGTGAGAAGGTGG + Intergenic
990765571 5:59178377-59178399 CCTGAGGCCTAGGGACAAGGGGG - Intronic
991476541 5:67026850-67026872 GGTGAGGCCCAAAGATAAGGAGG - Intronic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
998147811 5:139740226-139740248 GCTAAGGCTCAGAGTGAAGCAGG - Intergenic
998154443 5:139776403-139776425 CCTGAGGCCCAGAGAGGAGCAGG + Intergenic
998163692 5:139828268-139828290 GTTGAGGCAAACAGAGAAGGAGG + Intronic
998182507 5:139955353-139955375 GCAGAGGCCCAGAGGGGAGAGGG + Intronic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998699485 5:144681632-144681654 GCAGAAGCCAAGAGAGAAGGAGG + Intergenic
998800035 5:145859841-145859863 GCCGTGGCACAGAGAGCAGGTGG + Exonic
998849910 5:146342681-146342703 GCTGAGGCCCAGGGAGCTGGGGG - Intergenic
999193967 5:149769546-149769568 CCTGAAGCCCAGAGAGGACGAGG - Intronic
999238643 5:150114828-150114850 ACTGAGGCCCAGAGAGGGTGAGG + Exonic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999250792 5:150181115-150181137 GCTGAGGTGCAGTGAGAAGGGGG - Intronic
999259557 5:150229493-150229515 ACTGAGGCTCAGAGAGATGAAGG + Intronic
999268504 5:150282642-150282664 GCTAAGGCCCAGAGAGGGTGAGG - Intronic
999281316 5:150368069-150368091 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
999370350 5:151051493-151051515 ACTGAGGCCCAGGGAGAGGCAGG - Intronic
999411192 5:151351218-151351240 ACTGAGGCCCAGATAGGAGAAGG + Intergenic
999425519 5:151484869-151484891 ACTGAGCCCCAGGGAGAGGGTGG - Intronic
999460085 5:151750179-151750201 ACTGAGGCCCAGAGAGGACTGGG - Intronic
999519365 5:152334799-152334821 GCTGAGGCCCAGAGAAAAGAAGG - Intergenic
999687788 5:154117972-154117994 GCTGGAGCACAGAGAGGAGGTGG - Intronic
999749282 5:154614767-154614789 GCTGAGGCTCAGAGAGGGAGAGG + Intergenic
999749408 5:154615747-154615769 ACTGGGACCCAGAGAGAAGCAGG - Intergenic
999756171 5:154666110-154666132 GCCAAGGCTCAGAGAGAAAGAGG - Intergenic
999763637 5:154722053-154722075 CCTGAGGCACAGAGAGAAATTGG - Intronic
1001249175 5:170132998-170133020 TCTGAGGCACAGAGAGGAGAAGG - Intergenic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001405910 5:171477456-171477478 ACTGAGGTCCAGAGAAAAGAAGG - Intergenic
1001419248 5:171574246-171574268 ACTGAGGCCCAGAGACAAGAAGG - Intergenic
1001562162 5:172676992-172677014 ACTGAGGCCCAGAGAAAGGCAGG + Intronic
1001634006 5:173196904-173196926 GCTGAGACCCACAGGGAAGTGGG + Intergenic
1001672318 5:173484256-173484278 ACTGAGGCACAGAGAGATGAAGG + Intergenic
1001772749 5:174308266-174308288 ACTGAGGCCCAGAGAGAGAGAGG + Intergenic
1001876970 5:175210135-175210157 GTGAAGACCCAGAGAGAAGGTGG - Intergenic
1002170400 5:177371283-177371305 GCTGTGGCCCAGGAGGAAGGGGG + Intronic
1002199736 5:177521007-177521029 GCTTAGGCCCAGAGAGGAGCTGG + Intronic
1002596796 5:180328960-180328982 GCTGAGGCCCAGAGGGCAGGTGG - Intronic
1002679042 5:180946606-180946628 GCAGAGGGCAAGAGAGAATGGGG + Intronic
1003070241 6:2939835-2939857 GCTAAGGCCCAGTGAGAAATAGG - Intergenic
1003164944 6:3669524-3669546 CCAGAGGCCCAGAGATAAGCTGG + Intergenic
1005560829 6:27039261-27039283 GCCAGGGCCCAGGGAGAAGGTGG - Intergenic
1005898092 6:30195477-30195499 ACTGAGGTCCAGAGAGTGGGAGG - Intronic
1005954872 6:30656752-30656774 GCTGAGGCCTGGAAAGAAAGGGG + Exonic
1005960256 6:30688678-30688700 CCTGGGGCCGAGAGAGCAGGTGG + Exonic
1005967852 6:30740503-30740525 GCAGAGGCCAAGAGAGATGCTGG - Exonic
1006019396 6:31108948-31108970 ACTGAGGCCCAGAGAGGATGGGG - Intergenic
1006371926 6:33650150-33650172 GCTGAAGGGCAGAGAGAAGGAGG - Intronic
1006378743 6:33685679-33685701 GCTGGGGCCCAGCGAGTAGCGGG - Exonic
1006416177 6:33905352-33905374 GGTGTGGCCCTGAGATAAGGAGG - Intergenic
1006579283 6:35067302-35067324 GCATGGGCCCAGAGAGGAGGGGG - Intronic
1006778670 6:36616928-36616950 CCTGAGGCCCAGGGAGGAGGAGG + Intergenic
1006806290 6:36791829-36791851 ACTGAGGCCCGGAGAGGAGAAGG - Intronic
1006921081 6:37627600-37627622 ACTGAGGCTTAGAGAGGAGGAGG - Intergenic
1006929763 6:37680720-37680742 GCTGAGGCCCAGAGGGGAGTTGG - Intronic
1007061807 6:38947557-38947579 GCTGAGGCACAGGAAGAAAGCGG - Intronic
1007253215 6:40510579-40510601 GCTGAGGCACAGTGAGGAGTGGG + Intronic
1007299684 6:40857463-40857485 CCTGAGGCCCAGGGAGATGAAGG + Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007625614 6:43244582-43244604 CCTCAGACACAGAGAGAAGGAGG + Intronic
1007774862 6:44219403-44219425 GGGGAGGGGCAGAGAGAAGGGGG + Intergenic
1007989959 6:46244722-46244744 ACTAAGGCCCAGAGCGAAGCAGG - Intronic
1008039532 6:46782326-46782348 GCTGATGCCCTGATGGAAGGGGG + Intergenic
1008063008 6:47018332-47018354 ACTGAGGCCCAATGAGAAGTTGG + Intronic
1008892806 6:56514551-56514573 CCTGTGCCCAAGAGAGAAGGAGG - Intronic
1008912915 6:56756092-56756114 GCTTTGGCCCTGAGAGGAGGAGG + Intronic
1009194778 6:60670384-60670406 GCAGAGGGCAAGAGAAAAGGAGG - Intergenic
1009450282 6:63792015-63792037 GTTGAGGAAGAGAGAGAAGGTGG + Intronic
1010681764 6:78807259-78807281 GCTCTGTCCCAGAGAGATGGGGG + Intergenic
1010765853 6:79776887-79776909 GCTGAGGGCCTGAGATAGGGAGG - Intergenic
1011410319 6:87059949-87059971 GCTGAGGCCCCGTGAGAATTCGG + Intergenic
1011759762 6:90549606-90549628 ACTGAGGACCAGTGAAAAGGTGG + Intronic
1012397213 6:98812175-98812197 GGTGTGGCCCAGAAAGAAGCTGG + Intergenic
1012732947 6:102904951-102904973 GCTGCTGCCCAGAGAAAAGTGGG - Intergenic
1012950449 6:105512583-105512605 GCTGAGACCCAAAAGGAAGGGGG - Intergenic
1013025072 6:106263362-106263384 GCTGTGTCCCAGGGAGATGGGGG - Intronic
1014545874 6:122734617-122734639 ACTGAGGCGCAGAGAGAAAGTGG + Intergenic
1014787015 6:125630903-125630925 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
1016138365 6:140576138-140576160 GCTGAGGCCCAGAGAAACAGTGG + Intergenic
1016410275 6:143775497-143775519 TCTGAGGCCCAGAGAGATTAAGG + Intronic
1016940395 6:149478693-149478715 ACTGGGGCCCTGGGAGAAGGAGG - Intronic
1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG + Intergenic
1017983381 6:159421963-159421985 GCTGTGGGCCAGGGAGACGGGGG + Intergenic
1018398301 6:163398452-163398474 GCTGAGGCCCAGGGAACTGGAGG + Intergenic
1018513864 6:164556556-164556578 TGTGAGGACCAGAGGGAAGGCGG - Intergenic
1019175563 6:170157664-170157686 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175571 6:170157704-170157726 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175580 6:170157745-170157767 GCTGGGTCACAGAGAGACGGCGG + Intergenic
1019175588 6:170157786-170157808 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175608 6:170157869-170157891 GCTGGGTCACAGAGAGATGGTGG + Intergenic
1019175645 6:170158077-170158099 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175671 6:170158202-170158224 GCTGGGTCACAGAGAGATGGTGG + Intergenic
1019341286 7:510268-510290 ACTGAGGCCCAGGGAGGAGAAGG - Intronic
1019402962 7:866750-866772 GCGAAGGCCCAGGGAGACGGTGG - Intronic
1019475664 7:1242908-1242930 GCAGAGGCCCAGAGAGGGGAAGG + Intergenic
1019492810 7:1323056-1323078 ACTGAGGCCCAGAGAGGCGCAGG + Intergenic
1019503817 7:1380511-1380533 GCTGAGCCCCAGAAAGCAGCAGG + Intergenic
1019557130 7:1638151-1638173 ACTGAGGCCAAGAGAGAGGCAGG + Intergenic
1019634309 7:2067336-2067358 ACTGAGACCCAGAGAGAATGAGG + Intronic
1019644472 7:2121643-2121665 GCTTGGGCCCAGAGCCAAGGTGG + Intronic
1019688278 7:2394734-2394756 GCTGAGGCCTGGGGAGAAGCCGG + Intergenic
1019703883 7:2488271-2488293 ACTGAGGCTCAGAGAGACGGGGG + Intergenic
1019705071 7:2493750-2493772 GATGAGGCCCAGAGAGGGGCTGG - Intergenic
1019712173 7:2522732-2522754 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1019712306 7:2523339-2523361 GGTGAGGCCCAGAGCTAAGGGGG - Intronic
1019998934 7:4743752-4743774 CCTCAGGTCCAGAGAGAAGCAGG + Intronic
1020111897 7:5452172-5452194 ACTGAGGCCCCGAGAGGTGGTGG - Intronic
1020771654 7:12403500-12403522 GCAGAGGGACAGAGAGGAGGCGG + Intronic
1021448817 7:20762061-20762083 GCAGAGGCAGAGAGAGATGGAGG - Intronic
1021607294 7:22420871-22420893 ACTGAGGCACAGAGAGAATAGGG + Intronic
1022247602 7:28575603-28575625 GCTGAGGACCAGTGACAAGCCGG - Intronic
1022785133 7:33631113-33631135 ACTGAGGCCCTGAGACCAGGAGG + Intergenic
1023212932 7:37827739-37827761 GCTGGAGCCCAGGGATAAGGAGG - Intronic
1023475279 7:40571048-40571070 ACTGAGGCCCAGAAAGAAAGTGG - Intronic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1023843921 7:44110739-44110761 GCTGAAGCCCACGAAGAAGGTGG - Exonic
1024064460 7:45720916-45720938 TCTGAGGCCCAGAGAGGTTGGGG + Exonic
1024153576 7:46597901-46597923 GAAGAAGCCCAGAGAGAAGTAGG - Intergenic
1025607376 7:63048987-63049009 GCAGGGGGACAGAGAGAAGGAGG - Intergenic
1025775717 7:64559088-64559110 ACTGAGGGAGAGAGAGAAGGGGG - Intronic
1026603380 7:71795330-71795352 GCTGGGCCCCAGAGAAAAAGAGG - Intronic
1026868760 7:73838296-73838318 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1028970620 7:96854582-96854604 GCTGATGCAGAGAGAGAAGCAGG + Intergenic
1029280224 7:99430557-99430579 ACTGAGGCACAGAGAGATGAAGG - Intronic
1029422061 7:100476969-100476991 GCTGAGACCAAGACAGAAGAAGG + Intronic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1029727361 7:102415926-102415948 GCTGAGGGACAGAGAGCTGGGGG - Intronic
1030196849 7:106860882-106860904 GCTGAGGGGATGAGAGAAGGGGG + Intergenic
1030930901 7:115522174-115522196 GCAGAATGCCAGAGAGAAGGAGG - Intergenic
1033228178 7:139576943-139576965 GCTGAGGCACAGGGACATGGGGG - Intronic
1034834342 7:154337775-154337797 GCTCACGCCCAGGGAGAAGGTGG + Intronic
1035446589 7:158947419-158947441 GAAGAGGCCCAAAGAAAAGGAGG - Intronic
1035468010 7:159092238-159092260 GCTGGGGCCCAGAGCGAAATTGG + Intronic
1035535873 8:391072-391094 GCTGAGGGCCACTGGGAAGGAGG - Intergenic
1035764969 8:2098536-2098558 ACTGAGGCCCAGAGAGGCGACGG - Intronic
1035950896 8:4019535-4019557 GCTCAGGCACAGAGGGAATGGGG - Intronic
1036219289 8:6907786-6907808 GAGGAGGCCCAGAGAGGGGGAGG + Intergenic
1036612564 8:10362849-10362871 GCTGGGGCCAGGAGGGAAGGAGG - Intronic
1036781680 8:11651980-11652002 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
1036782909 8:11662084-11662106 ATTGAGGCCCAGAGAAAAGAAGG + Intergenic
1037601621 8:20401072-20401094 GCAGAGGGCCTGAGAGAAGAGGG + Intergenic
1037884047 8:22586985-22587007 CCTGAGGCCCAGGGAGAGGAAGG - Intronic
1038181505 8:25233046-25233068 GCAGAGAACCAGAGAGAAGAGGG - Intronic
1038334680 8:26636610-26636632 CCTGAGGGACAGAGAGGAGGAGG - Intronic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1039494695 8:37972152-37972174 CCTGAGGCCCAGAGAGGAAATGG + Intergenic
1040570613 8:48605945-48605967 ACTGTGGCCCAAAGAGAATGAGG + Intergenic
1040946786 8:52893127-52893149 GGTGTGGCCCAGCGAGAAGATGG + Intergenic
1041230837 8:55749651-55749673 ACTCAGGCACAGAGAGATGGAGG - Intronic
1041383700 8:57278380-57278402 GCTGGGGCCCAGAGGGGAAGCGG - Intergenic
1041537014 8:58937875-58937897 GCTTAGTCCCAAAGAGAAGTAGG + Intronic
1041670765 8:60489542-60489564 GCAGAGGAACAGAGTGAAGGAGG - Intergenic
1041713770 8:60915214-60915236 TCAGAGGCCAGGAGAGAAGGAGG - Intergenic
1041932462 8:63301935-63301957 GCTGAGGTCCATGGAGAAGGAGG + Intergenic
1042214862 8:66420598-66420620 GAAGAGGCACAGAGAGAAGCTGG + Intergenic
1042216408 8:66432814-66432836 ACTGAGGCCCAGAGAGGACCTGG + Intronic
1042443209 8:68851952-68851974 CATGAGGCCCAGCAAGAAGGAGG + Intergenic
1042499563 8:69493049-69493071 GCAGAGGAGCAGAGATAAGGTGG - Intronic
1044159832 8:88899363-88899385 GCTGAGGCAGAGAGAGAGAGGGG - Intergenic
1044911155 8:97060598-97060620 GCTGAGGCACATAGAAGAGGAGG - Intronic
1044967375 8:97586336-97586358 GATGAGGCCCAGGAAGCAGGTGG + Intergenic
1045501157 8:102745434-102745456 GCTGAGGCCCAGACAGGGTGGGG - Intergenic
1045502535 8:102754290-102754312 GCAGAGGCCCAGAGCGGAGATGG + Intergenic
1045522239 8:102913576-102913598 GGTGAGGGCGTGAGAGAAGGAGG + Intronic
1045866064 8:106866913-106866935 GAGGAGGCCCAGACAGAGGGAGG + Intergenic
1045972660 8:108096822-108096844 GGTGTGGCACAGAGTGAAGGAGG + Intergenic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046834100 8:118780082-118780104 GGAGAGACACAGAGAGAAGGAGG - Intergenic
1046886104 8:119368855-119368877 GTTGAGGACCTGAAAGAAGGTGG - Intergenic
1046893084 8:119444458-119444480 ACTAAGGCCCAGAGAGAATAAGG - Intergenic
1046933625 8:119865698-119865720 ACTGAGGCCCAGAGAGGACTAGG - Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1047576477 8:126161208-126161230 GCTGCGGCCCAGAAACAATGTGG - Intergenic
1047941054 8:129827563-129827585 GCAGAAGTGCAGAGAGAAGGTGG + Intergenic
1048267327 8:132999049-132999071 ACTGCAGCCCAGAGTGAAGGAGG + Intronic
1048281091 8:133106176-133106198 ACTGAGCCTCAGAGAGATGGAGG + Intronic
1048334430 8:133492133-133492155 GCAGAGGCCCAGCAAGCAGGTGG + Intronic
1048442567 8:134470573-134470595 GTTGAGGCCCAGAGCAAAGAGGG + Intergenic
1049016360 8:139922831-139922853 GCTCAGGCCCAGAGAGCTGAAGG + Intronic
1049154232 8:141057096-141057118 GCTGTGGGGCAGAGAGAAGGGGG - Intergenic
1049203009 8:141350985-141351007 ACTGAGGCCCAGAGAGGGGCAGG + Intergenic
1049261061 8:141639448-141639470 ACTGAGGCCCAGAGAGGGAGCGG + Intergenic
1049272044 8:141701086-141701108 GCCCAGGCCCAGAGGGGAGGGGG + Intergenic
1049439994 8:142605002-142605024 GTTGAGGGTCAGAGAGAAGGTGG - Intergenic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1049576767 8:143393300-143393322 ACACAGACCCAGAGAGAAGGAGG - Intergenic
1049579034 8:143402603-143402625 GGAGAAGCACAGAGAGAAGGCGG - Intergenic
1049624655 8:143614584-143614606 GCTGAGGCCCAGCCAGGAGTCGG - Intronic
1049643412 8:143725603-143725625 ACTGAGGCACAAAGAGATGGCGG + Exonic
1049802204 8:144523079-144523101 GCCCAGGCCCAGCTAGAAGGCGG - Exonic
1050119069 9:2289364-2289386 GCTGATGCCCAGAGAGGCGAGGG - Intergenic
1050204537 9:3182702-3182724 GATGAGAGACAGAGAGAAGGAGG - Intergenic
1050388453 9:5112985-5113007 GATGAGGCTCAGAGTGATGGGGG + Intronic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1052902416 9:33804808-33804830 GCTGAAGAACAGAGAGAAAGTGG - Intergenic
1053002285 9:34583786-34583808 GCCCAGGCCCGGAGAGAAGGCGG - Intronic
1053203638 9:36169021-36169043 ACTGAGGCCCAGAGAAGAGAAGG - Intergenic
1053303868 9:36970326-36970348 ACAAAGGCCCTGAGAGAAGGGGG + Intronic
1053467139 9:38316806-38316828 ACTGAGGGTCAGAGAGGAGGAGG - Intergenic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1053600365 9:39603617-39603639 GCTGAGGCTCAGAGAGATTAAGG + Intergenic
1053858016 9:42357473-42357495 GCTGAGGCTCAGAGAGATTAAGG + Intergenic
1054253163 9:62738767-62738789 GCTGAGGCTCAGAGAGATTAAGG - Intergenic
1054567279 9:66773266-66773288 GCTGAGGCTCAGAGAGATTAAGG - Intergenic
1054949700 9:70836198-70836220 GATGGGGCCCAGAGCTAAGGAGG - Intronic
1055108072 9:72533035-72533057 GCTGGGGCTAAGGGAGAAGGAGG + Intronic
1056552491 9:87663592-87663614 GCAGAGGCCTAGGGAGAAGCAGG - Intronic
1057421884 9:94919430-94919452 TCTCAGGGCCAGAGGGAAGGAGG + Intronic
1057743727 9:97734858-97734880 GCTGAGGCCCAGGGAGAGACAGG - Intergenic
1057745800 9:97750010-97750032 TCTGAGACCCAGAGAGTAGCAGG + Intergenic
1057876293 9:98756928-98756950 ACTGAGGCCCAGAGAGCTCGGGG - Intronic
1057899072 9:98933609-98933631 ACTCATGCCCAGAGAGAAGAAGG - Intergenic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059391391 9:114001763-114001785 ACTGAGGCCCAGAGATGGGGGGG + Intronic
1059411524 9:114135295-114135317 GCACAGGCCCAGAGAGGAGATGG - Intergenic
1059415894 9:114162328-114162350 ACTGAGGCCCAGAGAAGGGGAGG + Intronic
1059429078 9:114239431-114239453 GCTGAGGCCCAGAGAGGCTAAGG + Intronic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1059460406 9:114426033-114426055 ACTGAGGCCAAGAGAGGAGAGGG + Intronic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1059792092 9:117651079-117651101 GGTGAGGACCATAGAGAATGGGG + Intergenic
1059930794 9:119258608-119258630 ACTGAGGCCCATAGAGAGAGAGG + Intronic
1059984763 9:119811389-119811411 TGTGAAGCCCAGAGAGAAGTTGG - Intergenic
1060047413 9:120351686-120351708 GCTGAGGCCCAGAGAGTTTAAGG + Intergenic
1060156601 9:121324656-121324678 GCTGCAGCCCAGAGAGGCGGTGG - Intronic
1060207864 9:121693209-121693231 TCTGAGGCCCAGAGGGCAGTGGG - Intronic
1060282990 9:122226537-122226559 GCTGGGGCCCGGAGTGAAAGAGG - Intronic
1060399278 9:123338744-123338766 GTTGAGGCCCTGAGAGAAGCAGG + Intergenic
1060413041 9:123412413-123412435 GCTGAGTCCCACATAGCAGGAGG - Intronic
1060557617 9:124517132-124517154 GCTGAGGCTCTGGCAGAAGGTGG - Intergenic
1060674033 9:125496108-125496130 AATGAGGCCCACAAAGAAGGAGG + Intronic
1060754945 9:126205926-126205948 GCTGAGTCCCACAGAGAAGCTGG + Intergenic
1061131753 9:128712491-128712513 ACTGAGGCCCAGGGAGCAGGTGG + Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061181432 9:129027340-129027362 ACTGAGGCCCAGTGAGATGAAGG + Intronic
1061211387 9:129195410-129195432 ACTGAGGCCCAGAGAGGGGGGGG + Intergenic
1061236384 9:129345246-129345268 GGTGATGGCCAGGGAGAAGGAGG + Intergenic
1061281058 9:129597772-129597794 GCTGAGGCCCAGCGACAGGTAGG - Intergenic
1061281121 9:129598007-129598029 GCTGAGGCCCAGAGAGGGCCAGG - Intergenic
1061290124 9:129645999-129646021 ACTGAGGCCCAGAGACCAGAAGG - Intergenic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061499451 9:130993642-130993664 CCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1061502960 9:131014097-131014119 TGGGAGGCCCAGAGAGAAAGAGG - Intronic
1061765032 9:132876179-132876201 GCTGAGGCCCAGAGAAGGGAAGG - Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1061993482 9:134172658-134172680 CCTGAGGGCCTGAAAGAAGGAGG + Intergenic
1062107311 9:134762776-134762798 GCTGAGGCCCACACAGGAGCAGG - Intronic
1062195832 9:135273444-135273466 GCTGAGGCTCAGAGAGGCAGGGG + Intergenic
1062385691 9:136310678-136310700 GCTGGGGCCCAGAGGGTGGGGGG - Intergenic
1062395212 9:136350041-136350063 ACTGAGGCCCAAAGAGAGGCGGG - Intronic
1062428016 9:136514945-136514967 TCTGAGGCCCAGAGAGGCAGAGG + Intronic
1062486217 9:136777619-136777641 CCTGAGGCCCAGGGAGGAGCCGG - Intergenic
1062501139 9:136852556-136852578 CCTGAGCCCCAAAGGGAAGGAGG + Intronic
1062557612 9:137122019-137122041 GCCGAGGCGGAGAGAGAATGGGG - Intergenic
1062581473 9:137230959-137230981 GCTGAGGCCCAGGGACAGTGAGG + Intronic
1062642312 9:137525529-137525551 GCCGAGGCGGAGAGAGAATGGGG + Intronic
1062682291 9:137788358-137788380 GCTGAGGCGCTGGCAGAAGGCGG - Intronic
1185511994 X:670697-670719 CCTCAGGCCCAGGGAGAGGGTGG + Intergenic
1185683702 X:1909789-1909811 GCTGAGGCCCAGGAGGGAGGGGG - Intergenic
1186036984 X:5434503-5434525 GCTGAAGGCAAGAGAGAATGGGG + Intergenic
1187166185 X:16806278-16806300 GCTGATGCCCCGAGAGTATGGGG + Intronic
1187274423 X:17805605-17805627 GCTGAGGCCCAGTGGGATGAAGG + Intronic
1187288806 X:17932274-17932296 GCTGGGGCCATGAGAGAAGGTGG - Intergenic
1187440840 X:19318461-19318483 GATGAGGCCCTGAGGGAAGGGGG + Intergenic
1189131486 X:38502639-38502661 CCTGATGCTCAGAGAGAGGGTGG + Intronic
1189200255 X:39188948-39188970 TCAGAGACCCAGAGAGGAGGGGG - Intergenic
1189292416 X:39895655-39895677 GGTGGAGCCCAAAGAGAAGGAGG + Intergenic
1189865273 X:45321171-45321193 GATGAGGCCAAGAGAGGAGTAGG - Intergenic
1190094460 X:47467478-47467500 GCTGAGGCCCAGCGTGAACATGG - Exonic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1192087044 X:68110530-68110552 CCTGTGGCCCAGAGAGTGGGAGG + Intronic
1192181832 X:68920982-68921004 GATGAGGCCCAGAGAGGGGCAGG - Intergenic
1192198392 X:69047749-69047771 ACTGAGGCCCAGAGAAGAAGAGG + Intergenic
1192203272 X:69080770-69080792 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
1192204344 X:69086225-69086247 GATGAGGCCCAGAGAGGTGAAGG - Intergenic
1192235687 X:69294165-69294187 GCAAAGGCCCAGAGGGAGGGAGG + Intergenic
1192342944 X:70279004-70279026 CCTGAGGCTCAGAGAGAAGAAGG + Intronic
1192639340 X:72847520-72847542 GCTGAGGCCCTGAGAGTGGCAGG + Intronic
1192642371 X:72873285-72873307 GCTGAGGCCCTGAGAGTGGCAGG - Intronic
1194436525 X:93874137-93874159 GCTGAGACCCAGAGGAGAGGGGG - Intergenic
1194475905 X:94359930-94359952 GCAGAGGCCCACAGAAAAGGTGG + Intergenic
1195885431 X:109632643-109632665 ACTGAGGTCCAGAGAGGAGAAGG + Intronic
1195920095 X:109975050-109975072 TCTGAGATCCAGAGAGAAGCTGG - Intergenic
1196755774 X:119156027-119156049 CCTGAGGACCAGAGAGCTGGAGG - Intergenic
1197102506 X:122673058-122673080 TTTCAGACCCAGAGAGAAGGCGG - Intergenic
1198018645 X:132636610-132636632 ACTGAGGCCCAGAGAGAGACAGG + Intronic
1198030244 X:132747617-132747639 ACTGAGGCCCACAGAGAGGGAGG - Intronic
1198051997 X:132959100-132959122 ACTGAGGCCCAGAGAGGGGTAGG + Intronic
1198427424 X:136533765-136533787 ACTGAGGCCCATAGAGGAGAAGG + Intronic
1198523122 X:137472804-137472826 GCTGAGGCTCAGAGAGGTTGTGG - Intergenic
1198805935 X:140494737-140494759 ACTGAGGCCCAGAGAGACACAGG - Intergenic
1199677110 X:150198149-150198171 GCTAAGGCCTAGAGAGGAGAAGG - Intergenic
1199700953 X:150375175-150375197 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1199719542 X:150532632-150532654 GCAGAGGCCTAGAGAGAAGCTGG + Intergenic
1199757678 X:150880530-150880552 GCTGAGGGCCAGGGGGAAGGTGG + Intronic
1199850860 X:151724250-151724272 ACTGAGGACCAGAGAGAAAGAGG - Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200056239 X:153462835-153462857 GCTGATGCCCAGAGAGGGGTGGG - Intronic
1200162584 X:154017034-154017056 GCTGAGGCCAGGAGAGAGGTGGG + Exonic
1200247374 X:154533334-154533356 GCTGAGGCCCAGAGAGGCAATGG + Intronic
1201312728 Y:12611764-12611786 GGTGATGCCAAAAGAGAAGGTGG + Intergenic