ID: 967319673

View in Genome Browser
Species Human (GRCh38)
Location 3:188183261-188183283
Sequence CAAAGAGGACATAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 506}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967319673_967319680 -5 Left 967319673 3:188183261-188183283 CCACCTTCCTTATGTCCTCTTTG 0: 1
1: 0
2: 4
3: 59
4: 506
Right 967319680 3:188183279-188183301 CTTTGGGGCTATGATTGAAGAGG 0: 1
1: 0
2: 0
3: 33
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967319673 Original CRISPR CAAAGAGGACATAAGGAAGG TGG (reversed) Intronic
900922190 1:5680091-5680113 CAAAGAGTAAATCAAGAAGGAGG + Intergenic
901620613 1:10583100-10583122 CAAAGAGGGAATCAAGAAGGTGG + Intronic
901911767 1:12464573-12464595 CTAAAAGAACATAAGGAGGGGGG - Intronic
902556634 1:17250677-17250699 CAAGGAGGTAATGAGGAAGGAGG + Intronic
902934678 1:19756248-19756270 CAAAAAAGAAAAAAGGAAGGTGG + Intronic
903291563 1:22317483-22317505 CAAAGGGGCCAGGAGGAAGGGGG + Intergenic
903773329 1:25777782-25777804 AACAGAGGACATAATGGAGGAGG + Intronic
905942284 1:41873725-41873747 AAAAAAGGACAGAGGGAAGGAGG + Intronic
906673154 1:47674890-47674912 CACAGAGGAAATACGGAAGTGGG - Intergenic
906835341 1:49077812-49077834 CAAAGATGACCAAAGGGAGGAGG + Intronic
907922846 1:58929526-58929548 AAAAGAGAGCATAAGGAGGGCGG - Intergenic
908989348 1:70067061-70067083 CAAAGAGGATATACAGATGGAGG - Intronic
909030181 1:70530212-70530234 GAAGGAGGACATAAAGGAGGAGG - Intergenic
909973402 1:82018182-82018204 CAAAGAGAAAAGAAGGAAGGTGG - Intergenic
911237054 1:95422901-95422923 CAAAGAGGATGTAAGGTAAGTGG + Intergenic
912112058 1:106355413-106355435 CAAACAGGACTTTAGGAATGTGG - Intergenic
912344080 1:108947876-108947898 CAAAGAGAACATGGGGAAGCAGG - Intronic
912708311 1:111931221-111931243 GAAAGAGGTGAGAAGGAAGGAGG + Intronic
913309333 1:117472187-117472209 ATAAGAGGACATAGAGAAGGCGG - Intronic
913984139 1:143550076-143550098 CATAGAGGAGATAGGGAAAGAGG - Intergenic
915044878 1:153003889-153003911 CAATGGGGAAACAAGGAAGGAGG - Intergenic
915046839 1:153024622-153024644 CAATGGGGAAACAAGGAAGGAGG - Intergenic
915297454 1:154931203-154931225 CAAAGATGGCATATAGAAGGGGG + Intronic
916409119 1:164527435-164527457 CAAAGAGGAAACAAGTAAGTGGG + Intergenic
917511647 1:175674053-175674075 CAAAGAGGAAACAAGGGAGAAGG + Intronic
917520051 1:175740792-175740814 CACAGAGGACTCAATGAAGGTGG + Intronic
918666618 1:187159021-187159043 GAAAGAGGAAGGAAGGAAGGAGG - Intergenic
920102014 1:203522542-203522564 CAAAGGGAATATTAGGAAGGTGG + Intergenic
920912069 1:210228319-210228341 GAAAGAGCACAAAAGGAAGAGGG + Intergenic
921740810 1:218682303-218682325 CAGAGATGCCACAAGGAAGGAGG + Intergenic
922645599 1:227283622-227283644 GAAAGAGGACAGAAGTACGGAGG + Intronic
922943096 1:229485761-229485783 CAAAGAGGACAGAAGGGATGAGG + Intronic
923028002 1:230221958-230221980 AAAAGAAGACAGAAGTAAGGAGG - Intronic
923239330 1:232065900-232065922 CAAAGAAGACATAAATAAGCAGG + Intergenic
923567085 1:235084309-235084331 CAAAGAGGACAAAAGGGCGCTGG + Intergenic
923942129 1:238840043-238840065 CAAAGAGCACTAAAGGAAGGAGG + Intergenic
924078675 1:240369150-240369172 CAAAGAGTAGAAAAGGCAGGAGG - Intronic
924441590 1:244090022-244090044 CAAAGAGTACACAAGGGGGGCGG + Intergenic
924581425 1:245327264-245327286 CATATAGGGCATAAGTAAGGGGG - Intronic
1064421731 10:15196687-15196709 AAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1064963505 10:20992417-20992439 CAAAGAGAACATGGGGAAGCAGG + Intronic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1065542146 10:26781061-26781083 CAAACAGGTCATAAGGATTGTGG - Intronic
1065811925 10:29450508-29450530 CAAAGAGAAGATCTGGAAGGAGG - Intergenic
1065919281 10:30377463-30377485 CATAGAGGACAAATGGAAGGGGG + Intergenic
1065959855 10:30725649-30725671 CAAAGAGAAGATCTGGAAGGAGG + Intergenic
1066010391 10:31188944-31188966 GAAACATGCCATAAGGAAGGTGG + Intergenic
1066428843 10:35334022-35334044 CAAAGAGGAGATAGGGAAAGAGG + Intronic
1066625592 10:37402189-37402211 CAAAAAGGAAGGAAGGAAGGAGG - Intergenic
1067228200 10:44388953-44388975 CACAGATGACATCAGCAAGGCGG - Intergenic
1067399387 10:45957002-45957024 GAAAAAGGAAAAAAGGAAGGGGG + Intergenic
1067516181 10:46946970-46946992 TAAAAAGGAAATAAGGAAGCAGG - Intronic
1067646066 10:48104837-48104859 TAAAAAGGAAATAAGGAAGCAGG + Intergenic
1067867706 10:49926218-49926240 GAAAAAGGAAAAAAGGAAGGGGG + Intronic
1069942847 10:71966689-71966711 CACAGAGGGCATAATGAAGGTGG - Intronic
1070762119 10:79030351-79030373 CAAAGAGAAGAAAAGGATGGAGG - Intergenic
1071132516 10:82411267-82411289 GAAAGAGGAGAAAAAGAAGGAGG + Intronic
1071367694 10:84916667-84916689 CTCAGAGGACAGAAAGAAGGAGG - Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071849379 10:89552984-89553006 CAAAGTGGACAGAGGGACGGAGG - Intronic
1071873117 10:89816682-89816704 CAAAGAAGTGACAAGGAAGGAGG - Intergenic
1072070164 10:91908336-91908358 CAACGAGGGCAAGAGGAAGGCGG - Exonic
1073068729 10:100780127-100780149 GAAAGAGGCCATGAGGAAGGAGG - Intronic
1073094726 10:100972666-100972688 CTAAGAGGTCAGAAGGAGGGAGG - Intronic
1073209172 10:101784387-101784409 GAAAGAGGAGAAAAGGGAGGGGG + Intergenic
1073770670 10:106731905-106731927 CAGGGAGGACAAGAGGAAGGAGG + Intronic
1073862848 10:107767266-107767288 CAAAGAGCCCACAAGCAAGGTGG + Intergenic
1074338086 10:112598545-112598567 CAAAGAAGACAAAAGTAATGGGG + Intronic
1074718014 10:116237849-116237871 CAAAAAGGTCACAAGGAAGTGGG + Intronic
1074799488 10:116984967-116984989 AAAAGAGGAGATAGGGAAGATGG - Intronic
1075287583 10:121200711-121200733 CAGAGAGGAGAAAAGGCAGGGGG + Intergenic
1075765949 10:124893014-124893036 CAAAGAAGACACAGGGAAGAAGG - Intergenic
1075838591 10:125477624-125477646 TAAAGAGGAGAGAAGAAAGGTGG + Intergenic
1076162366 10:128255248-128255270 CAGACAGGACATAAGCCAGGAGG - Intergenic
1076252361 10:128994640-128994662 AAAGGAGGAAAAAAGGAAGGAGG + Intergenic
1076556793 10:131328920-131328942 CAAAGAGGATACAAAGATGGTGG - Intergenic
1078519438 11:12051415-12051437 CAGAGAGGCCATAAGGGATGTGG - Intergenic
1079320151 11:19445187-19445209 GGAAGAGGAAATAAGGAATGTGG + Intronic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080702506 11:34656161-34656183 CAAAGAGGAGATGATGGAGGCGG - Intronic
1081501864 11:43674905-43674927 ATAATAGGACATAAGGAAAGAGG - Intronic
1082639965 11:55647260-55647282 GAAAGGGGCCATAAGGAAGCTGG + Intergenic
1083044591 11:59722319-59722341 CAAAGAGGAAAGAAGCAAGATGG - Intronic
1083836326 11:65270943-65270965 GAAAGAGGACAGAAGGAGGAGGG - Intronic
1084477772 11:69398683-69398705 CGACGAGGACAGGAGGAAGGAGG + Intergenic
1086906499 11:92424024-92424046 TAAAGAGGACAAATGGAGGGTGG + Intronic
1087593665 11:100225520-100225542 CTAAAAGGAAAGAAGGAAGGAGG - Intronic
1088197676 11:107293863-107293885 CAAGGAGGGCAAGAGGAAGGAGG + Intergenic
1088297260 11:108313315-108313337 AAAAGAGAACATAGGGAAGAGGG - Intronic
1089580683 11:119480354-119480376 AAGAGAGGACACCAGGAAGGGGG - Intergenic
1090435721 11:126684933-126684955 AGAAGAGGACAAAAGGGAGGGGG - Intronic
1090590588 11:128262700-128262722 GAAACAGGACATAGGGAGGGGGG + Intergenic
1091659084 12:2369326-2369348 CAAAGAAGTTTTAAGGAAGGTGG + Intronic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092829749 12:12432276-12432298 GAAAGAGGAAAAGAGGAAGGAGG - Intronic
1093078656 12:14784154-14784176 GAAAGAGGACAGAAGGCAGGTGG - Intergenic
1093197650 12:16147747-16147769 TAAAGAGGAGATTATGAAGGAGG + Intergenic
1093805373 12:23426025-23426047 CACAGAGGACACAAAGAAGTTGG - Intergenic
1094178320 12:27564761-27564783 CAAAGAGCAGATTAGGAAGAGGG - Intronic
1095364774 12:41389789-41389811 CAAAGAGGTCAAATGGAAGTTGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096573293 12:52537143-52537165 CAAAGTGGAAAAAAGGGAGGAGG - Intergenic
1096582653 12:52598168-52598190 CATGGAGAACCTAAGGAAGGAGG - Intronic
1096846319 12:54409012-54409034 AAGAGAGGGCATAGGGAAGGAGG + Intronic
1098158671 12:67626127-67626149 CAAAGAGAACAAAAGGGAGGAGG + Intergenic
1098559583 12:71856823-71856845 CAAAGAGTACATAATGAAAAAGG - Intronic
1098806736 12:75029857-75029879 TAAAGTGGACATACGGAAAGTGG + Intergenic
1099224177 12:79949407-79949429 GAAGGAGGACAGAGGGAAGGAGG - Intergenic
1099609391 12:84848327-84848349 GAAAGAGGAAGGAAGGAAGGTGG + Intergenic
1099728036 12:86459803-86459825 CAAAGAGGACAAGAAGAAAGGGG - Intronic
1099923212 12:88984780-88984802 GAAAGAAGACATAAGAAGGGTGG + Intergenic
1100080572 12:90844415-90844437 CAAAGTGGACATAAGACAGTAGG - Intergenic
1100174296 12:92011935-92011957 CAGAAAGGAAAAAAGGAAGGAGG + Intronic
1100982867 12:100176219-100176241 CAAAGATGACAGATGGAAGGAGG + Intergenic
1101549636 12:105750057-105750079 CAAAGTGATAATAAGGAAGGAGG - Intergenic
1101826209 12:108221973-108221995 CTAAGAGGACATTAGGAATTTGG - Intronic
1102976468 12:117210290-117210312 CAAAGAGGACATTTGGATGCAGG + Exonic
1103214909 12:119194511-119194533 CACAGGGGACAGAAGAAAGGGGG - Exonic
1103319718 12:120084944-120084966 GAAAGAGAACAGAAGGGAGGGGG - Intronic
1104760156 12:131293305-131293327 CACTGAGGACATAAAGCAGGGGG - Intergenic
1105037482 12:132937056-132937078 CAAAGAAAATATATGGAAGGTGG + Intronic
1106337681 13:28798622-28798644 CACATAGGAGATAAGAAAGGGGG - Intergenic
1107343282 13:39432522-39432544 CAAAGATGACATAGGAGAGGGGG - Intronic
1107498265 13:40949798-40949820 CTAAGAGGAAAAAAGGTAGGTGG - Exonic
1107585227 13:41840017-41840039 CAGAGAGGACATAAGCAAATGGG - Intronic
1107952525 13:45476838-45476860 GAAAGAGGAGACAAGGAAAGTGG - Intronic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108130350 13:47292796-47292818 GAAAGGAGACAGAAGGAAGGAGG + Intergenic
1108707382 13:53001919-53001941 CAAAGAGAATATACAGAAGGGGG - Intergenic
1109613723 13:64802178-64802200 CCAGGACGACATAGGGAAGGAGG + Intergenic
1111156257 13:84330628-84330650 CAAAGAGGAACTAAAGTAGGGGG - Intergenic
1111871861 13:93843436-93843458 TAAAGGGGAGATAAGGAATGAGG + Intronic
1111994539 13:95151505-95151527 CAAAGAGGAAAGAAGGAAGAAGG + Intronic
1112919706 13:104596833-104596855 CAAAGGGGAGGTAAAGAAGGAGG + Intergenic
1112953566 13:105032516-105032538 CAAAAAGGACAGAAGGTAGAAGG + Intergenic
1113473040 13:110560309-110560331 CAAAGAAGGCAAAAGGGAGGGGG + Intronic
1114293024 14:21304324-21304346 AAAAGAGGAAAGAAGGAAGGAGG + Intronic
1114600389 14:23951670-23951692 CACAGGGGACATTAGGGAGGGGG - Intergenic
1114610030 14:24034074-24034096 CACAGGGGACATTAGGGAGGGGG - Intergenic
1115243003 14:31267859-31267881 CAAAGAATACATATGGAAAGGGG - Intergenic
1116047296 14:39760309-39760331 CAAAGAGGAGAGAAGAAAGGAGG + Intergenic
1116312025 14:43340066-43340088 GAAAGAGAAAATAAAGAAGGAGG + Intergenic
1116590783 14:46769656-46769678 GAAAGAGGGGATAAAGAAGGGGG + Intergenic
1117221530 14:53611369-53611391 TGAAGAGGACATATGGAAGGAGG + Intergenic
1117965048 14:61198460-61198482 CTTAGGGGACATAGGGAAGGAGG - Intronic
1118426048 14:65663678-65663700 CATAGAGGACATAAAGAAAGAGG - Intronic
1118689032 14:68320581-68320603 CAAAGAGGAAAGCAGGGAGGAGG - Intronic
1119448735 14:74689428-74689450 CATAGAGAATAAAAGGAAGGAGG - Intronic
1120010919 14:79413348-79413370 CAAACAGCACAGATGGAAGGAGG - Intronic
1120592621 14:86393654-86393676 GAAAGAGGAAAGAAAGAAGGAGG - Intergenic
1120677939 14:87443526-87443548 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1121017075 14:90555391-90555413 ATAAGAGGACCTAGGGAAGGGGG + Intronic
1121624604 14:95374946-95374968 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624635 14:95375049-95375071 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121682591 14:95806143-95806165 CAAAGAGGCCAGAAGGCAGTGGG - Intergenic
1122578493 14:102756519-102756541 GAAAGAAGAAATAAGGAAGGAGG - Intergenic
1123470137 15:20544530-20544552 CGAAGACGACAAATGGAAGGCGG + Intergenic
1123647916 15:22456167-22456189 CGAAGACGACAAATGGAAGGCGG - Intergenic
1123727822 15:23122348-23122370 CGAAGATGACAAATGGAAGGGGG - Intergenic
1123730435 15:23139526-23139548 CGAAGATGACAAATGGAAGGGGG + Intergenic
1123748573 15:23336944-23336966 CGAAGATGACAAATGGAAGGGGG + Intergenic
1124039125 15:26083891-26083913 CAAAAAGCACAAAAGGATGGAGG + Intergenic
1124088606 15:26576759-26576781 CATAGAGGCCATCAAGAAGGGGG + Intronic
1124280950 15:28360822-28360844 CGAAGACGACAAATGGAAGGCGG + Intergenic
1124301754 15:28550803-28550825 CGAAGACGACAAATGGAAGGCGG - Intergenic
1124531827 15:30515305-30515327 CAAAGATGACAAATGGAAGGGGG - Intergenic
1124562529 15:30788436-30788458 CAACGATGACAAATGGAAGGGGG - Intergenic
1124766830 15:32492385-32492407 CAAAGATGACAAATGGAAGGGGG + Intergenic
1124961509 15:34400156-34400178 CAAAGAGGACATGACGAGGGAGG + Intronic
1124978135 15:34546379-34546401 CAAAGAGGACATGACGAGGGAGG + Intronic
1125175131 15:36812297-36812319 CAAAGATTAAATAAGGAAGATGG + Intergenic
1125255479 15:37758410-37758432 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1127038228 15:54943712-54943734 AAAAGAGAACATTAGGAATGAGG + Intergenic
1127549467 15:60022830-60022852 CAAAGAGGACAGGAGGATAGGGG - Intronic
1127777219 15:62273969-62273991 CAAAGACAACAAATGGAAGGGGG + Intergenic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1128612319 15:69084064-69084086 CAGGGAGGACATAAGGCTGGAGG + Intergenic
1128697628 15:69780470-69780492 CAGAGCTGACATCAGGAAGGAGG + Intergenic
1128716891 15:69915187-69915209 CTAAGAGGACATGAGGCAGGAGG - Intergenic
1128896199 15:71376324-71376346 AAACTAGGGCATAAGGAAGGAGG - Intronic
1129036366 15:72651695-72651717 CAAAGAGGACAAATGGAAACGGG - Intergenic
1129213521 15:74085530-74085552 CAAAGAGGACAAATGGAAACGGG + Intergenic
1129306472 15:74667902-74667924 CAAAGAGTACATATGTAAAGGGG + Intronic
1129396879 15:75255555-75255577 CAAAGAGGACAAATGGAAACGGG - Intergenic
1129400491 15:75279833-75279855 CAAAGAGGACAAATGGAAACGGG - Intronic
1129730654 15:77929851-77929873 CAAAGAGGACAAATGGAAGGGGG + Intergenic
1129837286 15:78718148-78718170 CAAAGATGACAAATGGAAAGGGG - Intronic
1130056913 15:80533889-80533911 AAAAGAGGACATCAGGAAAATGG - Intronic
1130222298 15:82029938-82029960 CAAAGAAGACAAAGTGAAGGCGG + Intergenic
1130266546 15:82410056-82410078 CAAAGAGGACATGACAAGGGAGG - Intergenic
1130505482 15:84536829-84536851 CAAAGAGGACATGACAAGGGAGG + Intergenic
1130509361 15:84575644-84575666 CGAAGAGGACAAATGGGAGGGGG + Intergenic
1131187679 15:90289185-90289207 CAAAGAGGACAAATGGAAGGGGG - Intronic
1131362444 15:91805474-91805496 AAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1131913154 15:97231504-97231526 AAGAGAGGAAAGAAGGAAGGAGG + Intergenic
1132495446 16:261077-261099 CAGATAGGAGAAAAGGAAGGGGG + Intronic
1132989191 16:2784473-2784495 CAAAGAGGAGAGGAGGCAGGAGG + Exonic
1133716961 16:8459009-8459031 AAAAAAGAACAGAAGGAAGGCGG - Intergenic
1133793128 16:9024967-9024989 CAAAGAGTGAATAAGGAAGATGG - Intergenic
1134234657 16:12455828-12455850 CAAGCAGGAAAGAAGGAAGGAGG - Intronic
1134538017 16:15042064-15042086 ACAAGAGAACATAAGGAAGTCGG + Intronic
1134822544 16:17258334-17258356 GAAATAGGAAAGAAGGAAGGGGG + Intronic
1134880727 16:17743573-17743595 CAAAGTGGAGGTAAGGAATGAGG + Intergenic
1135473383 16:22752035-22752057 CACAGAGGCCATAAAGCAGGTGG + Intergenic
1137849277 16:51722555-51722577 CAAAGAGGAAAGAAAGAAAGAGG + Intergenic
1138498365 16:57422976-57422998 CAAAAAGGAAGGAAGGAAGGAGG + Intergenic
1139007453 16:62590586-62590608 CAAAGAACCCATGAGGAAGGAGG + Intergenic
1139762035 16:69192132-69192154 CAAAGAGGAAAGACCGAAGGTGG + Intronic
1140288656 16:73629139-73629161 CACAGATGACACACGGAAGGTGG - Intergenic
1140857477 16:78990687-78990709 CATAGAGGAAAGAAGGAAGAAGG + Intronic
1140947685 16:79785244-79785266 CAAATAGGATATGAGGATGGAGG - Intergenic
1141476284 16:84275533-84275555 CAAAAAGGAACTAATGAAGGAGG + Intergenic
1143601593 17:7949513-7949535 CAAAGAGGAGAGAGGGTAGGGGG - Exonic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144376514 17:14647721-14647743 AAAAGAGGAGAGAAGGAAAGGGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1147949963 17:44101867-44101889 TAAAGAGGAGATGAGGTAGGGGG + Intronic
1148391577 17:47276525-47276547 CAAAGAAAACAAATGGAAGGAGG + Intronic
1148540426 17:48475993-48476015 CATAGAGGACATAAGGACATAGG + Intergenic
1149723280 17:58866903-58866925 CAAAGATGACAAAAGGAAGGAGG + Intronic
1149751656 17:59151959-59151981 CAAAGAGAAAATAATGATGGGGG + Intronic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1151489094 17:74421698-74421720 GAAAGAGGGCACAAGAAAGGAGG + Intergenic
1152014245 17:77739374-77739396 CCAAGAGGACTTCAGGATGGAGG + Intergenic
1152472836 17:80499931-80499953 CAAAGAGGCCAGAGGGAGGGGGG + Intergenic
1152924977 17:83083053-83083075 GGAAGAGGACAAAATGAAGGTGG - Intronic
1153354504 18:4120791-4120813 GAAAGAGGAGAGAAGGAGGGAGG - Intronic
1153778448 18:8473983-8474005 CAATAAGGACAGAAGGAAGTGGG - Intergenic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1154931636 18:21003279-21003301 CAAAGAACACAAAAGGGAGGAGG + Intronic
1155449306 18:25946787-25946809 GAAGGAGGAAAGAAGGAAGGAGG + Intergenic
1156133708 18:34009292-34009314 CTAAAAGGAAATAAGGAAGAAGG + Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156563785 18:38160266-38160288 AGAAGAGGCCATAAGGAAAGGGG + Intergenic
1156635525 18:39023830-39023852 CAAAGTGGAGAAAAGCAAGGAGG - Intergenic
1157806081 18:50658567-50658589 TAAAGAGGACATGATGAAGATGG - Intronic
1157984923 18:52426225-52426247 CAATGAGAACATAATGAAGGTGG + Intronic
1158005980 18:52672624-52672646 AAAAGAGGAAAGAGGGAAGGAGG - Intronic
1158376318 18:56873472-56873494 CAAAAGGAACATAAAGAAGGTGG + Intronic
1158701176 18:59748638-59748660 GAAAAAGGAAAGAAGGAAGGAGG - Intergenic
1159212178 18:65338523-65338545 GAAGGAAGAAATAAGGAAGGAGG - Intergenic
1159250649 18:65871571-65871593 CAAAGAGGAAATGAAGAAGGTGG + Intronic
1159691749 18:71496547-71496569 AAAACAGGAAATATGGAAGGAGG + Intergenic
1159910520 18:74141394-74141416 TAAATAGCACATCAGGAAGGAGG - Intronic
1160236853 18:77092701-77092723 GAAGGAAGAAATAAGGAAGGGGG + Intronic
1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG + Exonic
1162104707 19:8363433-8363455 GAAAGAGGAAGGAAGGAAGGAGG - Intronic
1162552628 19:11366023-11366045 CACAGAGGGCACAAGGAATGGGG + Intergenic
1162917003 19:13880116-13880138 CCAAAAGGACATAGGGAAGATGG + Intronic
1164044921 19:21529015-21529037 CAAAGAAAACCTAAGGAAGAAGG - Intronic
1164771865 19:30815923-30815945 GAAAGAGGAGAAAAGGAGGGAGG - Intergenic
1164937074 19:32223357-32223379 GAAAAAGGAAAGAAGGAAGGAGG + Intergenic
1165409782 19:35652334-35652356 CAGACAGGACATAAAGAAGGTGG - Intronic
1165971686 19:39637132-39637154 TAAACAGGACCTATGGAAGGAGG - Intergenic
1166096432 19:40542264-40542286 CAAGGAGGACATGAGGAACACGG - Intronic
1167153944 19:47726646-47726668 GAAAGAGGATGTAAGGAAGGAGG - Intronic
1167625864 19:50588753-50588775 CAAAGAGGAAGTAAGGCAGCTGG + Intergenic
1168143976 19:54408743-54408765 GAAAGAGGAAAGAAGGAAGGAGG + Intergenic
1168712965 19:58512232-58512254 CAAGCAGGACAGCAGGAAGGAGG - Intronic
925986792 2:9222909-9222931 CAAAGAGGAAAAAAGTGAGGAGG - Intronic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
927099926 2:19780332-19780354 CAATAGGGAGATAAGGAAGGTGG - Intergenic
928081303 2:28314966-28314988 AAAAGAGAAAAGAAGGAAGGTGG + Intronic
929108768 2:38388820-38388842 AAAACAGGACAAAAGGGAGGCGG + Intergenic
929522454 2:42666323-42666345 CTAAAAGGATATAAGGTAGGAGG - Intronic
929584757 2:43106633-43106655 GAAAGAGCACAGAAGGCAGGTGG - Intergenic
929959478 2:46485453-46485475 CCTAGGGGACATAAGGAAGGAGG + Intergenic
929992394 2:46801149-46801171 CAAAGAGGACCGGGGGAAGGAGG - Intergenic
930558046 2:52924526-52924548 GAAGGAGGACAGAATGAAGGTGG - Intergenic
930771943 2:55137934-55137956 CTGAGAGGACATGAGGATGGAGG - Intergenic
930881257 2:56273239-56273261 GAAAGAGGCCACAAGGATGGGGG + Intronic
932625830 2:73295158-73295180 AAAAAAGGAGAGAAGGAAGGAGG - Intergenic
932843395 2:75107503-75107525 CAAGGATGAAAGAAGGAAGGGGG + Intronic
933350589 2:81147368-81147390 CAAACAGGGCATCAGTAAGGTGG - Intergenic
933634984 2:84699023-84699045 AAAAGAGCACAGAGGGAAGGAGG + Intronic
935383388 2:102476789-102476811 CAAAGAGAAGATGAAGAAGGAGG + Intronic
935703060 2:105829750-105829772 CAAAGAGTACATAGGGAAAGGGG - Intronic
935869266 2:107427364-107427386 CAGAGATGGGATAAGGAAGGTGG - Intergenic
936233622 2:110725136-110725158 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
936851726 2:116907326-116907348 GGAAGAGGAAACAAGGAAGGAGG - Intergenic
937273483 2:120670005-120670027 CAAAGAGGAGATGTGGGAGGGGG - Intergenic
937284163 2:120739427-120739449 CAAAGAGTACACAAGGATGTAGG - Intronic
937637769 2:124176121-124176143 CAAGGAAGACATTAGAAAGGAGG - Intronic
937913112 2:127085776-127085798 CACAGAGGAGCTAGGGAAGGGGG - Intronic
938581705 2:132652323-132652345 AAAAGACGACAGAAGGAAAGGGG + Intronic
939614297 2:144345521-144345543 CAAAGGGGACATGAAGAAAGGGG - Intergenic
939759244 2:146153895-146153917 GAAAGAGACCCTAAGGAAGGAGG + Intergenic
940314039 2:152308779-152308801 AAAAAAGAACATAAGGAAGAAGG + Intergenic
940996615 2:160156791-160156813 GAAAGAGAATATAAGGAAAGAGG - Intronic
941538131 2:166746124-166746146 CAGAGGTGACATCAGGAAGGTGG - Intergenic
942308775 2:174634763-174634785 TAAAGAGGAGATAAGCCAGGGGG + Intronic
943090753 2:183372036-183372058 CAAAGAGGAGAGAAGGAAGATGG + Intergenic
943914358 2:193609775-193609797 CAAAGAGTATAAAAAGAAGGGGG + Intergenic
944522503 2:200586374-200586396 AAAGGGGAACATAAGGAAGGTGG - Intronic
944775585 2:202960790-202960812 GAAAGAGGAGGGAAGGAAGGAGG - Intronic
946088996 2:217203912-217203934 CAAAGAGAAAATTAGGAAAGTGG - Intergenic
946548587 2:220775382-220775404 CCAAGAGGACACAATGAAGATGG + Intergenic
947548093 2:231026323-231026345 CATGGAGGACATTAGGAAGAAGG + Intergenic
947577940 2:231291823-231291845 AAAAGAGGCCTTTAGGAAGGTGG + Intronic
948181220 2:235982427-235982449 CTAGGAGGTCAGAAGGAAGGGGG + Intronic
948185202 2:236015633-236015655 CCAAGCGCACATAAGGGAGGCGG + Intronic
948209603 2:236183092-236183114 GAAAGAGGAGATAGAGAAGGAGG - Intergenic
948491000 2:238313497-238313519 CAAAGATGACACCAGGAGGGTGG - Intergenic
1168820357 20:768812-768834 CCAAGAGGACCCAAGGAGGGAGG + Intergenic
1169541805 20:6607436-6607458 GAAAGAGGAAAGAAGGAAGGAGG + Intergenic
1169550828 20:6699520-6699542 GAAAGAGGAAGGAAGGAAGGAGG - Intergenic
1170663253 20:18363073-18363095 GCACGAGGACATGAGGAAGGAGG + Intergenic
1170920301 20:20671939-20671961 CAAAGAGGGAAGAAGAAAGGAGG + Intronic
1171077837 20:22147217-22147239 CAAAGAAGACATAAGTCAGGAGG + Intergenic
1171332805 20:24356400-24356422 GAAAGAGGACAGAGGGGAGGGGG + Intergenic
1171785820 20:29463965-29463987 GAAAGAGGAGGGAAGGAAGGAGG - Intergenic
1172448272 20:35004276-35004298 CAGACAGGGCCTAAGGAAGGAGG - Intronic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1173106783 20:40144444-40144466 AAAAGAGGATCTGAGGAAGGTGG - Intergenic
1175043544 20:56079477-56079499 CAAGGATGAGATAGGGAAGGAGG - Intergenic
1175418018 20:58814455-58814477 CAAAGAGTACACATTGAAGGTGG - Intergenic
1176945031 21:14969540-14969562 CAAAATTGACCTAAGGAAGGGGG + Intronic
1177190712 21:17848106-17848128 CAATGAGGGACTAAGGAAGGGGG - Intergenic
1179505992 21:41841074-41841096 CACAGAGAAAATAGGGAAGGAGG + Intronic
1182167353 22:28189386-28189408 CAAAGAAATCCTAAGGAAGGGGG + Intronic
1182411006 22:30186342-30186364 AAAAAAGGACAGAAGGAGGGAGG - Intergenic
1182743555 22:32587305-32587327 GAGAGAGGACATAGGGAGGGAGG + Intronic
1182822817 22:33233432-33233454 GAGAGAGGACAAGAGGAAGGAGG - Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1185172149 22:49300318-49300340 CAAAGAGGAAATGTGGGAGGCGG + Intergenic
949148161 3:729801-729823 GAAAGAAGGAATAAGGAAGGAGG - Intergenic
949482287 3:4505101-4505123 CCAAGAGGCCATAAGGCAGTTGG - Intronic
949497390 3:4645449-4645471 CAAAGACGACATATTAAAGGGGG + Exonic
949828775 3:8191451-8191473 GAAAAAGGAGAAAAGGAAGGAGG - Intergenic
950091009 3:10294423-10294445 AGAAGAGGACACAAGGAAAGGGG - Intronic
950689570 3:14645134-14645156 CAAAGAGTAGATAAGGAAAGTGG + Intergenic
950865905 3:16188868-16188890 GAGAGAGGACACAAGGAGGGAGG - Intronic
951226396 3:20126133-20126155 TAAAAAGGAAATAAGGAAGAAGG - Intronic
951653874 3:24982641-24982663 GAAAGAGGAGAAAAGGGAGGAGG - Intergenic
952635800 3:35529227-35529249 CAAAGGGGACATGGGGTAGGAGG + Intergenic
952710055 3:36421107-36421129 CAGAGAGGAAAAAAGGAAGGAGG - Intronic
953118504 3:40016119-40016141 AGAAGAGGACAGAAGGAAGAAGG - Intronic
953291134 3:41664383-41664405 GACAGAGGACATAAGGAAACCGG - Intronic
954185494 3:48914046-48914068 CAAATAGGAGAAAAGAAAGGTGG + Intergenic
955247994 3:57246631-57246653 CAAAGAGTACATCAGGAAGGGGG + Intronic
955925276 3:63998187-63998209 CAAAAAGGACAGAAGGGGGGGGG + Intronic
956447969 3:69344345-69344367 GAAAAAGGACAGAAGGAGGGAGG + Intronic
957340840 3:78894556-78894578 CAAAGATGAAATAAAGAAGAAGG + Intronic
957571452 3:81951807-81951829 CGAAGAGGCCATAAGGAGAGGGG + Intergenic
958484089 3:94681022-94681044 CAAAGAGGACACAAAGAAAATGG + Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958929720 3:100196213-100196235 CAACAAGGAGATAAAGAAGGAGG - Intergenic
959951498 3:112184949-112184971 CACAGAGCACATTAGAAAGGGGG + Intronic
960305220 3:116052216-116052238 AAAGGAGGAGAAAAGGAAGGAGG + Intronic
961921164 3:130428041-130428063 CAAAGAAGACCAAAGGTAGGTGG + Intronic
962733805 3:138306349-138306371 AAAAGAGGACACAAGGACAGTGG + Intronic
962927974 3:140012548-140012570 CAAAGGGGACCCAAGGAAGAGGG + Intronic
962994523 3:140612180-140612202 CACATAGGACATGAGAAAGGGGG + Intergenic
963214698 3:142732119-142732141 AAAAGAGTAAACAAGGAAGGGGG + Intronic
963323608 3:143836610-143836632 GAGAGGGGACAGAAGGAAGGAGG + Intronic
963397783 3:144756340-144756362 GAAAGAGGAGATAATAAAGGGGG - Intergenic
964140189 3:153389216-153389238 CAAAAGGGAAAGAAGGAAGGAGG + Intergenic
964144442 3:153441952-153441974 AAAAAAGGAAAGAAGGAAGGAGG - Intergenic
965503532 3:169484293-169484315 GAAAGAGGAGATAAAGAAGAGGG + Intronic
965954506 3:174352331-174352353 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
966960551 3:184933575-184933597 CAAGCAGGACATAAAGAGGGGGG - Intronic
967143711 3:186587381-186587403 CAAAATGGAGATAATGAAGGGGG + Intronic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
967337451 3:188360407-188360429 CAAAGAGGAGAGAGAGAAGGAGG - Intronic
967484472 3:190014570-190014592 GAAATGGGACATTAGGAAGGAGG + Intronic
967657092 3:192063511-192063533 AAAAGAGGAAATAAGGAAAAAGG + Intergenic
967868368 3:194208710-194208732 CAAAGAGGATATAAGGACAACGG + Intergenic
968570489 4:1338009-1338031 CAAAGAGGGGACAAGGGAGGGGG - Intronic
969224568 4:5786913-5786935 CAATGAGGAAATATGGCAGGTGG - Intronic
970159341 4:13173304-13173326 AAAAGAGGAAAGAAGGAAGGAGG + Intergenic
970231453 4:13915455-13915477 CAGAGAGGACAAAAGGGAGGTGG - Intergenic
970296867 4:14639910-14639932 CAAAGCAGAAATATGGAAGGTGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972902974 4:43708022-43708044 GGAAGAGGACAGAAGGAAGAAGG + Intergenic
972902984 4:43708054-43708076 GGAAGAGGACATAAGGAAGAAGG + Intergenic
973614662 4:52666349-52666371 GAAAGAGGAAAAAGGGAAGGAGG + Intergenic
973730993 4:53822191-53822213 TACAGTGGTCATAAGGAAGGTGG + Intronic
974122642 4:57658070-57658092 CAAAATGGACATAGAGAAGGGGG + Intergenic
974208144 4:58734355-58734377 CAAATAAGATATAAGAAAGGGGG - Intergenic
975445235 4:74456356-74456378 AAAAGAGGATCTAAGGAAGCTGG + Intergenic
976285949 4:83371206-83371228 GAAAGAGAACACCAGGAAGGGGG + Intergenic
976798619 4:88962447-88962469 CAAAGAGGAAAGAAAGGAGGTGG + Intronic
976871637 4:89801002-89801024 CAAAGAGGAAACAGGGAGGGAGG + Intronic
977811307 4:101358801-101358823 CAAAGATGAAAGAAGGAAGACGG + Intergenic
978439962 4:108723155-108723177 CAAAGACGGCAAAAGGAAGGAGG - Intergenic
980221134 4:129917440-129917462 CAAAAAGAATATAAGGAGGGAGG + Intergenic
980288540 4:130813401-130813423 CTAAGAGAAGATAAAGAAGGAGG - Intergenic
980391025 4:132146743-132146765 CAAAGACGACAAAAAGAAGGAGG - Intergenic
980594454 4:134935051-134935073 TAAAGAGGACATCACCAAGGTGG + Intergenic
981365918 4:143903020-143903042 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981386548 4:144138192-144138214 AAAAGAGGACAGAAGGCAGAGGG - Intronic
981988045 4:150881513-150881535 CAAGAAGGAGAGAAGGAAGGGGG + Intronic
983200171 4:164852685-164852707 AAAAAAGGAAAGAAGGAAGGAGG + Intergenic
983263206 4:165478938-165478960 CATTGAGGACTTCAGGAAGGAGG - Intronic
984042054 4:174747214-174747236 CAACGAGGACATAAGGGCAGTGG + Intronic
984333271 4:178354704-178354726 CAAAGAGGAAGGAAGGAAAGAGG + Intergenic
984740787 4:183159806-183159828 CAAATAAGGCATATGGAAGGAGG - Intronic
984951373 4:185010214-185010236 AAAAGAGGAGATATGGGAGGAGG + Intergenic
985660215 5:1153257-1153279 CAAAGAGGAGATGAGGTGGGTGG + Intergenic
986530212 5:8728516-8728538 AAAAGAGAACCTTAGGAAGGAGG + Intergenic
987523503 5:19018287-19018309 AAAAGAGGAGAAAAGAAAGGAGG - Intergenic
988114095 5:26861371-26861393 GAAAGAGGAGATAAGAAAGTTGG - Intergenic
988785511 5:34562933-34562955 CAAAGAGCACATAGGGAGGGCGG + Intergenic
989714917 5:44451579-44451601 CAAAGATGGCAAAAGGAAGGAGG + Intergenic
990334570 5:54759517-54759539 AAAAGAGGAAAGGAGGAAGGAGG - Intergenic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991619739 5:68533210-68533232 GAAAGAGGAAGTAGGGAAGGGGG + Intergenic
992297032 5:75336184-75336206 CAAAGAGAACATAAGCAGGGAGG + Intergenic
992603422 5:78429129-78429151 AAAGGAGGAAAAAAGGAAGGTGG - Intronic
992623447 5:78616035-78616057 AACAGAGGGCAGAAGGAAGGAGG - Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
993251073 5:85523946-85523968 GAATGAGGAGATAAGGAAGTTGG - Intergenic
993681545 5:90884635-90884657 CACAAAGCACATAAGGAAGAGGG - Intronic
994141095 5:96342175-96342197 CTCAGAGGAATTAAGGAAGGAGG - Intergenic
994159522 5:96541003-96541025 CAAAGAGCACATGGGAAAGGGGG - Intronic
994842303 5:104941195-104941217 AAAGGAGGAAAGAAGGAAGGAGG + Intergenic
995133390 5:108654534-108654556 CCAAGAAGAGATAAGGAAGCTGG + Intergenic
995647307 5:114327711-114327733 CAAAGAGGACATAACACAGAAGG - Intergenic
995899836 5:117052702-117052724 CAAAGAGGACCAAAGTGAGGTGG - Intergenic
997779804 5:136645139-136645161 CAAAAAAGCCAAAAGGAAGGAGG - Intergenic
998393785 5:141805241-141805263 CCAAGAAGAGACAAGGAAGGTGG + Intergenic
999132355 5:149294091-149294113 TACAGAGGACATAAGGAATGTGG - Intronic
999476214 5:151901201-151901223 AAATAAGGACATAAGGAAGCAGG - Intronic
999808606 5:155107209-155107231 CAACTAGGACATAAAGGAGGTGG - Intergenic
1000428048 5:161115970-161115992 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1000436658 5:161218984-161219006 CAATGAGGACAAAATGAATGGGG + Intergenic
1000865283 5:166506263-166506285 AAAAGGGGACATAGAGAAGGAGG - Intergenic
1000963031 5:167622799-167622821 CAAAGAGGAGACCAGGAGGGTGG + Intronic
1001436547 5:171703765-171703787 AAAAGAGGCCATGAGGGAGGAGG - Intergenic
1001758908 5:174191588-174191610 CAAGGAGGATACAGGGAAGGAGG - Intronic
1001845818 5:174920125-174920147 CAAGGAGGACAAATGGAAGGGGG + Intergenic
1002094874 5:176824806-176824828 CAGAGAGTACACAAGGTAGGGGG - Intronic
1003047405 6:2746376-2746398 CATAGAGGAAAGAAGGAAGATGG + Intronic
1003737775 6:8896852-8896874 GAAAGAGGAAGGAAGGAAGGAGG - Intergenic
1004772162 6:18796164-18796186 GAAAGAGGAGAGAAGGAAGGAGG - Intergenic
1005217840 6:23552814-23552836 CTAAGAGGATTTGAGGAAGGAGG + Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006174403 6:32113351-32113373 CAAAGTGGGCATAGGGCAGGAGG + Intronic
1006289673 6:33125085-33125107 GAAAGAGGAAAGAATGAAGGGGG + Intergenic
1007029185 6:38612602-38612624 CCAAGATGACTTAAGGAATGGGG + Intronic
1007039382 6:38707614-38707636 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1007304952 6:40896665-40896687 CAAAGGGAACATTAGGGAGGTGG - Intergenic
1007335237 6:41150811-41150833 CCAAGAGGAAACAAGGTAGGTGG - Exonic
1007735282 6:43978446-43978468 GAAAGAGAAGATAAGGATGGAGG - Intergenic
1008209679 6:48705065-48705087 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1008211919 6:48735880-48735902 CAGAGAGGAGATCAGGAAAGAGG + Intergenic
1008581208 6:52908981-52909003 CAAAGAGAACAAAGAGAAGGAGG + Intronic
1009701317 6:67185647-67185669 CAAATAGGAAAAGAGGAAGGAGG - Intergenic
1009769564 6:68127493-68127515 CATGGAGGACAGAAGGAAGTAGG - Intergenic
1009990601 6:70838718-70838740 AACAGAGGAGACAAGGAAGGAGG + Intronic
1010076533 6:71804509-71804531 CAATGAGATCATTAGGAAGGAGG + Intergenic
1011198297 6:84805330-84805352 GAAAGAAAACATTAGGAAGGTGG - Intergenic
1011672962 6:89701698-89701720 CACAGGGGAAATAAGGAAAGGGG + Intronic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1011931601 6:92721520-92721542 CAAAGAGAAATGAAGGAAGGGGG - Intergenic
1012420232 6:99056721-99056743 AAAAGAGGACATGTTGAAGGGGG + Intergenic
1012426296 6:99118489-99118511 CAAAGAAGTCACAAAGAAGGCGG + Intergenic
1012763168 6:103329764-103329786 CAAGGAGGAAATAATGCAGGAGG + Intergenic
1013721892 6:113040201-113040223 CAAAGAAGAGAGAAGCAAGGAGG - Intergenic
1015185256 6:130408549-130408571 CAAAGAGGACATGAGACATGTGG + Intronic
1015225408 6:130851858-130851880 AACAGAGGCCATAAAGAAGGAGG - Intronic
1015610003 6:135006748-135006770 GAGTGAGGAGATAAGGAAGGAGG + Intronic
1016165743 6:140940237-140940259 CAAAGAGTAGACAAGGAAAGTGG + Intergenic
1016521935 6:144955406-144955428 AAAAGAGGAAAGAAGGAAGGAGG - Intergenic
1016984514 6:149885043-149885065 CTAGGAGGACATAATGAAGAAGG - Intronic
1018116581 6:160591843-160591865 CAAATAAGACACAAGGAAAGGGG - Intronic
1018280557 6:162180917-162180939 CAAAGAGGACATCAGGGAACAGG + Intronic
1018524968 6:164699635-164699657 CCAAGAGAAGATTAGGAAGGAGG - Intergenic
1020887718 7:13840062-13840084 GAAAGAGGAGAAAAGAAAGGAGG + Intergenic
1022094172 7:27128817-27128839 GGAAGAGGAGGTAAGGAAGGTGG + Exonic
1022109384 7:27219288-27219310 CAAGGGAGACATAATGAAGGAGG + Intergenic
1022473396 7:30695072-30695094 GAAGGTGGACATGAGGAAGGAGG + Intronic
1023032450 7:36102375-36102397 AAAAAAGGAAAGAAGGAAGGGGG + Intergenic
1023233936 7:38064494-38064516 GAAAGATGACATAATGAAGCTGG + Intergenic
1023337421 7:39184892-39184914 AACAGAGGACATAGGAAAGGTGG + Intronic
1023397407 7:39763889-39763911 CAAGAAGGAAAAAAGGAAGGAGG - Intergenic
1024217489 7:47259675-47259697 CAAAGAGGAGAGAAGCAAGGAGG + Intergenic
1024256074 7:47540871-47540893 CAAAGCAGTCACAAGGAAGGAGG + Intronic
1025079514 7:55969531-55969553 CAATGATGACACAAGGAAGTAGG - Intronic
1025080830 7:55981053-55981075 CACAGAAGAAATAAGGAAGATGG - Intronic
1025789371 7:64673835-64673857 CAAAGCTGACATGAGGAATGCGG - Intronic
1028272888 7:88815609-88815631 GAAGGAGGACATTGGGAAGGAGG - Intronic
1031044601 7:116873944-116873966 GAAAGAGAACAAAGGGAAGGAGG - Intronic
1032511485 7:132475951-132475973 CAGAGAGAACATGAGGGAGGTGG + Intronic
1032709725 7:134451213-134451235 CACAAAGGACATGAGGCAGGAGG - Intronic
1033261116 7:139844909-139844931 CAATGAGGAAATGAGCAAGGAGG - Intronic
1033686211 7:143643541-143643563 AAAAGAGGAAATACGTAAGGAGG - Intronic
1033689527 7:143723774-143723796 AAAAGAGGAAATACGTAAGGAGG + Intronic
1033698402 7:143814080-143814102 AAAAGAGGAAATACGTAAGGAGG + Intergenic
1034434190 7:151055334-151055356 CAAAGAGGACATCCGGTGGGCGG + Exonic
1034939969 7:155224261-155224283 CACAGAGGAAAGAAGAAAGGAGG + Intergenic
1035684772 8:1515124-1515146 CAAAGAGAAAACAAGGAAGGAGG + Intronic
1035939835 8:3886786-3886808 CAAAGATTACAGAAGGAAGGAGG + Intronic
1036755524 8:11468418-11468440 CATGAAGGACATAAGGCAGGGGG - Intronic
1037774376 8:21823273-21823295 GAAAGAAGAGAGAAGGAAGGAGG - Intergenic
1038368987 8:26969186-26969208 CAAGGAGGGGTTAAGGAAGGAGG + Intergenic
1038532765 8:28331767-28331789 CAATCAGAACATGAGGAAGGAGG - Intronic
1038951128 8:32415745-32415767 TAAAAAGGGCATAGGGAAGGAGG - Intronic
1039521692 8:38176966-38176988 CGAAGAGGATATAAGGGTGGAGG - Exonic
1042063620 8:64848715-64848737 CACAGAGGAAATAAGCAAGAAGG - Intergenic
1042065689 8:64873087-64873109 CAATGAGGACAAAAGGAACTTGG - Intergenic
1042478426 8:69276567-69276589 GGAAGAGGACATTTGGAAGGGGG - Intergenic
1043591352 8:81836887-81836909 CACAGATCACATAGGGAAGGAGG - Intronic
1043832925 8:85011947-85011969 CAAAGAGAAGAAAAGGGAGGAGG - Intergenic
1043909851 8:85851308-85851330 AAAGGAGGAAAGAAGGAAGGAGG - Intergenic
1044035377 8:87296531-87296553 ACAAGAGGACATAAAGAAGCAGG + Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1045064714 8:98435123-98435145 CAATGAGGACACGAGGAAAGAGG + Intronic
1045410368 8:101911071-101911093 CAAGGAGGAAAGAAGGAAGCAGG + Intronic
1045475877 8:102551760-102551782 CAGAAGGGACATAAAGAAGGTGG + Exonic
1046483255 8:114851171-114851193 AAAAGAGGAAAGGAGGAAGGGGG + Intergenic
1047324048 8:123819439-123819461 GAAAGAGGAGGGAAGGAAGGTGG - Intergenic
1047785458 8:128150070-128150092 GAAAGAGGACATTAAGAAGGGGG + Intergenic
1047818295 8:128489396-128489418 CAGAGAGGACAGTAGGCAGGAGG + Intergenic
1048267820 8:133003212-133003234 AAGAAAGGAAATAAGGAAGGAGG + Intronic
1048291720 8:133186266-133186288 AAAAGAGGAAAAATGGAAGGAGG + Intergenic
1048729592 8:137423734-137423756 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1048919523 8:139215310-139215332 AAGAGAGGACCTTAGGAAGGAGG - Intergenic
1049300678 8:141867811-141867833 CACAGAGGACACAGGGGAGGAGG + Intergenic
1050769443 9:9178360-9178382 AAAAAAGGAAAGAAGGAAGGAGG - Intronic
1051874273 9:21774951-21774973 TAAAGATGACATCAGAAAGGTGG + Intergenic
1051939222 9:22484767-22484789 CAAGGAGGGCATAAGGCAGAAGG + Intergenic
1053001942 9:34581592-34581614 CATAGTGGTGATAAGGAAGGGGG - Intronic
1053329099 9:37187909-37187931 CACAGAGGACAAAAGGAAGTAGG - Intronic
1055175989 9:73318251-73318273 GAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1056009815 9:82315824-82315846 GCAAGAAGACAAAAGGAAGGAGG - Intergenic
1057303954 9:93901908-93901930 CACAGAGGAGATAAGGAAGCAGG + Intergenic
1058164036 9:101600650-101600672 CAAAGAGGCCCTAGGGCAGGAGG + Intronic
1058711399 9:107682276-107682298 AAAAGAGGAAATAGGGAAGGGGG - Intergenic
1059506446 9:114803709-114803731 GCAAGAGCACAGAAGGAAGGAGG - Intronic
1060000412 9:119953346-119953368 CAAGCAGGATAAAAGGAAGGAGG - Intergenic
1060673291 9:125489726-125489748 CAGAGAGGAGTTGAGGAAGGAGG + Intronic
1060858235 9:126933103-126933125 GTGAGAGGACAAAAGGAAGGCGG + Intronic
1060887040 9:127161584-127161606 CACAGTGGACATGAGGGAGGTGG + Intronic
1061240760 9:129370599-129370621 AAAAGATGACCTAAGGAAGAAGG - Intergenic
1061495381 9:130971006-130971028 GAAAGAGGAAGAAAGGAAGGAGG + Intergenic
1062608827 9:137363214-137363236 CAAAAAGGACATTAGGAGGAAGG - Intronic
1185823185 X:3224599-3224621 CAAAGAGGATAAATGGAAGTTGG - Intergenic
1186017839 X:5218122-5218144 TAAAGAGGAAGGAAGGAAGGAGG + Intergenic
1186069966 X:5808825-5808847 AAAAAAGGAAAAAAGGAAGGAGG - Intergenic
1186250502 X:7660676-7660698 CTAAGAAGACATCAGAAAGGAGG + Intergenic
1186361688 X:8848958-8848980 AAAAGAAGACATAATGATGGGGG + Intergenic
1186944045 X:14545314-14545336 GCAAGAGGGCATAAGGAAGAAGG + Intronic
1187186593 X:16992563-16992585 CAATAAAAACATAAGGAAGGTGG - Intronic
1189021342 X:37344896-37344918 AAAAAAGAACAAAAGGAAGGAGG - Intergenic
1189868427 X:45355774-45355796 CAAAGAGGACACAAGAAAACTGG - Intergenic
1189925560 X:45950498-45950520 CAAAAACAACATAAGGGAGGGGG - Intergenic
1189931652 X:46018465-46018487 CAAAGAGTACAGTAGGAAGAGGG - Intergenic
1190535141 X:51418404-51418426 CAAAGAGTAGAAGAGGAAGGAGG - Intergenic
1190876701 X:54465238-54465260 CAAAGAGAACATTCAGAAGGAGG + Intronic
1193993576 X:88339437-88339459 CCAAGAAGACATAAGGCAGAAGG - Intergenic
1194588406 X:95766652-95766674 CAAAGAGGACATAATACATGTGG + Intergenic
1194979777 X:100428444-100428466 CGTAGAGGCCATAAGGAAGAAGG - Intergenic
1196491036 X:116267121-116267143 CAAAGATCCCATAAGGGAGGTGG + Intergenic
1197175950 X:123486049-123486071 GAAAGAGGAAGAAAGGAAGGAGG + Intronic
1197453851 X:126652446-126652468 AAAGGATAACATAAGGAAGGAGG - Intergenic
1197562085 X:128036034-128036056 CAAAGATGACATAATGAAAATGG + Intergenic
1197809604 X:130429637-130429659 CCAAGAGGGCTTAGGGAAGGGGG + Intergenic
1197816314 X:130502270-130502292 AAAGGAGGACCGAAGGAAGGAGG - Intergenic
1198859994 X:141058507-141058529 AAAAAATGACATAAGGAAAGAGG + Intergenic
1198902699 X:141528883-141528905 AAAAAATGACATAAGGAAAGAGG - Intergenic
1199394644 X:147320969-147320991 CAAAGAGAACATTAGCAAGGAGG - Intergenic
1199430518 X:147754210-147754232 CAAAAAGGACCTGAGGAAGTTGG - Intergenic
1199555056 X:149098134-149098156 CAAGAAGGAGAGAAGGAAGGAGG + Intergenic
1199855448 X:151755655-151755677 GAAAGAGGAAAGAAGAAAGGAGG + Intergenic
1201470015 Y:14322795-14322817 GAAAGAAGAAAAAAGGAAGGGGG - Intergenic
1201989687 Y:20010004-20010026 CAAAGAGGACCAAAGAAAGTTGG + Intergenic
1202364472 Y:24147793-24147815 CAAAGAGGACATGACAAGGGAGG - Intergenic
1202506309 Y:25522329-25522351 CAAAGAGGACATGACAAGGGAGG + Intergenic