ID: 967319760

View in Genome Browser
Species Human (GRCh38)
Location 3:188183924-188183946
Sequence CTAGTTCAGTCTATCTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967319760_967319763 -6 Left 967319760 3:188183924-188183946 CCCATAGAGATAGACTGAACTAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 967319763 3:188183941-188183963 AACTAGTGTGTAAGGACCTATGG 0: 1
1: 0
2: 0
3: 1
4: 52
967319760_967319766 18 Left 967319760 3:188183924-188183946 CCCATAGAGATAGACTGAACTAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 967319766 3:188183965-188183987 AGCAGATGTCAAAAATGGAGTGG 0: 1
1: 0
2: 0
3: 33
4: 297
967319760_967319765 13 Left 967319760 3:188183924-188183946 CCCATAGAGATAGACTGAACTAG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 967319765 3:188183960-188183982 ATGGTAGCAGATGTCAAAAATGG 0: 1
1: 0
2: 1
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967319760 Original CRISPR CTAGTTCAGTCTATCTCTAT GGG (reversed) Intronic
906747249 1:48230753-48230775 CTCCTTCAGTCTTTCTCTCTGGG - Intronic
910156869 1:84229315-84229337 TTAATTCAGTCTATCTTTGTTGG + Intronic
910944597 1:92576727-92576749 CTAGTTCTGTCTATATCGCTGGG + Intronic
911068878 1:93816218-93816240 CTAGTTTATTCTATCACTGTAGG + Intronic
912284897 1:108358694-108358716 TTAATCCAGTCTATCACTATTGG + Intergenic
913483033 1:119307622-119307644 CCAGTTCAGACTATCTCTTTTGG - Intergenic
914949422 1:152099513-152099535 ATACTTCAGTCTTTCTTTATTGG + Intergenic
914990250 1:152493976-152493998 CTAGGCCAGTCTATATATATAGG + Intergenic
918903527 1:190458333-190458355 CTATTTCAGTATAACTTTATTGG - Intronic
1063395923 10:5687335-5687357 CTAGTTAAGGATATCTATATAGG - Intronic
1082971016 11:59020978-59021000 TTAATTCAGTCTATCATTATTGG - Intronic
1083033249 11:59613924-59613946 CTTGTTCAGCCTAACTCTCTGGG + Intronic
1087369323 11:97261769-97261791 CTTTTTCAGGCTATCTCTTTGGG - Intergenic
1089177235 11:116557695-116557717 CTATTTCTCTCTATCTCTCTGGG + Intergenic
1095662133 12:44749163-44749185 TCAGTTCAGTCTATCCCTAAAGG + Intronic
1096624837 12:52888316-52888338 CTTGGACAGACTATCTCTATAGG - Intergenic
1099623322 12:85032408-85032430 CTAGAACTGTCTTTCTCTATTGG - Intronic
1111076301 13:83240551-83240573 TTAATCCAGTCTATCACTATTGG + Intergenic
1111325520 13:86690944-86690966 GTATTACAATCTATCTCTATAGG - Intergenic
1114140912 14:19909507-19909529 TTAGTTCTGTATATTTCTATGGG + Intergenic
1116580120 14:46630218-46630240 CTACTTCAAGCTATCTGTATGGG + Intergenic
1116921458 14:50581900-50581922 CTAGTTCATTCTATCTTTCTAGG - Intronic
1117723777 14:58652421-58652443 CTAGTCCAGTCTTTCACTAAGGG + Intergenic
1118086248 14:62420959-62420981 CTAGTTTTGTCCAGCTCTATTGG - Intergenic
1120261143 14:82187860-82187882 CTATTTCAGTGTACCTCTTTAGG + Intergenic
1121341740 14:93109351-93109373 CTGGGGCAGTCTGTCTCTATAGG - Intronic
1121784523 14:96646836-96646858 AAAGTGCAGTCTATCTCTAGTGG + Intergenic
1123567857 15:21569457-21569479 TTAATCCAGTCTATCTTTATTGG + Intergenic
1127240660 15:57110671-57110693 GAAGTTCAGTCTATCTTTACAGG + Intronic
1127378985 15:58412037-58412059 TGAGTTCAGTGTATGTCTATTGG - Intronic
1127717854 15:61667443-61667465 CGAATTCAGTCTATTTCAATTGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1135621385 16:23958813-23958835 CTAGGTCAGTCTATTTCTGTAGG - Intronic
1144076364 17:11723143-11723165 CTAGTCCCGTCTCTCTCTAATGG + Intronic
1145687857 17:26693838-26693860 TTAATCCAGTCTATCTTTATTGG - Intergenic
1149983230 17:61328229-61328251 CTAGTTTTTTCTTTCTCTATAGG - Intronic
1151147263 17:72053003-72053025 ACAGTTCAGTCTATTTCTCTTGG - Intergenic
1153563932 18:6400323-6400345 CTATTTCACTCTATATCTACAGG - Intronic
1158233210 18:55282397-55282419 ACAGTTCAGTTTATCTCTAATGG + Intronic
1159919623 18:74215763-74215785 CTAGCTGTGTCTAGCTCTATGGG - Intergenic
1159980398 18:74771663-74771685 CTGGTGCAATCTATCTCAATTGG + Intronic
1160052458 18:75447671-75447693 CAAATTCTGTCTATCTCTTTTGG - Intergenic
929360878 2:41088767-41088789 TTAATCCAGTCTATCACTATTGG + Intergenic
930290394 2:49486077-49486099 TTAATCCAGTCTATCTCTGTTGG - Intergenic
932053704 2:68423650-68423672 CTACTGTAGTATATCTCTATGGG + Intergenic
932103318 2:68920781-68920803 GTAGTTCAGCCTGTCTCTTTTGG + Intergenic
932162705 2:69476716-69476738 CTATCTCTATCTATCTCTATTGG + Intronic
932861751 2:75300238-75300260 GTTTTTCAGTCTATCTCTCTTGG - Intergenic
935093102 2:99916028-99916050 CTAGTTCAGATTGTCTCTTTAGG - Intronic
939386034 2:141499558-141499580 CCAGTCCTGTCTCTCTCTATAGG - Intronic
940340455 2:152575650-152575672 CTAGGTAAGTTTATCTCTATAGG - Intronic
941063057 2:160869608-160869630 GTAGTTCAGTCTATTCCTGTGGG + Intergenic
942290424 2:174464141-174464163 CTAAATCAGTCTATCTTTTTGGG + Intronic
944881067 2:204013383-204013405 CTAGGTCTGTCTCTCTCTCTTGG - Intergenic
1171724494 20:28603380-28603402 CTAGCTTCCTCTATCTCTATCGG - Intergenic
1172470608 20:35191641-35191663 CTTGTTCGGTCTATCTAAATTGG - Intergenic
1177180129 21:17735937-17735959 CCATTTCTTTCTATCTCTATTGG + Intergenic
951054963 3:18136904-18136926 CAAACTCAGTCTATCACTATTGG - Intronic
952045870 3:29319261-29319283 CTCGTTCAGTGCATTTCTATGGG + Intronic
953161315 3:40422741-40422763 TTAATCCAGTCTATCACTATTGG + Intronic
955545443 3:60023739-60023761 CTAGTTGAGCCTATCTATAAAGG - Intronic
958666780 3:97150241-97150263 CTAAGTCAGGCCATCTCTATTGG + Intronic
959977368 3:112475701-112475723 GTAATTCAGTCTTTCTTTATGGG - Intronic
960722745 3:120640816-120640838 CCAGTTCAGTTTATCTCTGGGGG - Intronic
963842636 3:150123153-150123175 TTAGTCCAGTCTATCACTGTTGG + Intergenic
965373967 3:167898139-167898161 ATAGTTCAGCCTATCTTCATTGG + Intergenic
967319760 3:188183924-188183946 CTAGTTCAGTCTATCTCTATGGG - Intronic
968671521 4:1854851-1854873 CAACTTCAATCTATCTCTTTGGG + Intronic
970966263 4:21931662-21931684 CTAATTCAGTCTATCATTGTTGG + Intronic
974531625 4:63115521-63115543 TTAATCCAGTCTATCACTATTGG + Intergenic
977783901 4:101010484-101010506 CTAGTTCATGCTATTTCTCTAGG - Intergenic
978244663 4:106558473-106558495 CTAATCCAGTCTATCACTGTGGG + Intergenic
978548763 4:109901638-109901660 TTAATTCATTCTATCTGTATTGG + Intergenic
978992128 4:115097424-115097446 CTCTTTCTCTCTATCTCTATTGG + Intronic
980017940 4:127675052-127675074 GTAGTTAAGTCTATCTCTTTAGG - Intronic
980491848 4:133538229-133538251 TCATTTCAGTCTATCACTATTGG + Intergenic
981253405 4:142630806-142630828 GTAGGTAAGTCTATCTCTTTGGG + Intronic
983362262 4:166741891-166741913 TTAGTGCAGTCTATCTTTGTTGG + Intronic
983727722 4:170949752-170949774 TTAGGTCAGCTTATCTCTATGGG + Intergenic
987739733 5:21891693-21891715 ATAGTTGAATTTATCTCTATAGG + Intronic
989704452 5:44311858-44311880 CTAAGCCACTCTATCTCTATGGG - Intronic
991538294 5:67697579-67697601 CTACTTCAGATTATCTCTTTGGG - Intergenic
994415568 5:99465963-99465985 CTAGTTCAGTCTATTTTGAATGG + Intergenic
998961917 5:147497007-147497029 TTAATTCAGTCTATCGCTGTTGG - Intronic
1004586053 6:17001566-17001588 CTTGCACAGTCTATTTCTATGGG + Intergenic
1004586144 6:17002580-17002602 CTAGTTCTGTTTATCTCTTTGGG + Intergenic
1005551213 6:26918559-26918581 TTAATCCAGTCTATCACTATTGG + Intergenic
1008054609 6:46933510-46933532 CTAGGTCGGTCCATCTCTCTGGG - Intronic
1010082929 6:71885738-71885760 GTAGTTCAGAGTATCTCTGTAGG - Intergenic
1011718780 6:90133925-90133947 TTAATTCAGTCTATCACTGTTGG + Intronic
1012759902 6:103286204-103286226 CTACTTCAGTCTGTCAGTATTGG + Intergenic
1014068465 6:117153813-117153835 CCAGTTCAGATTATCTCTTTGGG - Intergenic
1015521584 6:134136758-134136780 TTAATTCAGTCTATCATTATTGG + Intergenic
1017683691 6:156889996-156890018 CCAGTCCAGGCTATCTCTTTAGG - Intronic
1018468629 6:164077035-164077057 CTAGTTCAGTCTAACTAGTTTGG + Intergenic
1018468632 6:164077109-164077131 CTAGTTCAGTCTAACTAGTTTGG + Intergenic
1018468634 6:164077146-164077168 CTAGTTCAGTCTAACTAGTTTGG + Intergenic
1019408300 7:895405-895427 CCAGTTCAGTCCAGCTCGATGGG - Exonic
1020686567 7:11303427-11303449 CTAGTTCAGTCAATCAATAGCGG + Intergenic
1022218283 7:28286925-28286947 CTAATCCAGGCTAACTCTATAGG + Intergenic
1023555499 7:41418415-41418437 CTGATTGAGTTTATCTCTATTGG - Intergenic
1024591043 7:50883815-50883837 ATAGTTCAGTCTATGAATATGGG + Intergenic
1024764745 7:52644457-52644479 TTAATCCAGTCTATCACTATTGG + Intergenic
1025822637 7:64983722-64983744 CTATCTCTGTCTATCTCTGTGGG - Intronic
1027520006 7:79194489-79194511 GTAATTCAGTCTATTTTTATTGG - Intronic
1035933388 8:3809609-3809631 CTAATTCAGTCTGTCTCTGGTGG + Intronic
1037434780 8:18851062-18851084 ACAGTTCAGTCTATCTCAACAGG + Intronic
1038473368 8:27844009-27844031 CTAGTGCACTCTAACTCTATGGG - Intergenic
1040676322 8:49755377-49755399 CTAATTCAGTTTATCTATGTCGG - Intergenic
1042492922 8:69421972-69421994 CTATTTCAGTCTATTTCCACAGG - Intergenic
1043518351 8:81017792-81017814 CTAATTAAGTCTATCTCTGGAGG - Intronic
1046565677 8:115897686-115897708 TTCCTTCATTCTATCTCTATTGG + Intergenic
1051262634 9:15279791-15279813 ATAGATCAGTCTATTACTATTGG + Intronic
1056452600 9:86730573-86730595 CATGTTCAGTGTCTCTCTATAGG + Intergenic
1058840050 9:108897572-108897594 CTAGTTCATTCTTTTTTTATTGG - Intronic
1186675215 X:11809087-11809109 ATAGTTCATGCTGTCTCTATGGG - Intergenic
1192022919 X:67413460-67413482 CTAATCCAGTCTATCACTGTTGG + Intergenic
1194233806 X:91357863-91357885 CGAATTCAGTCTATCTTGATTGG + Intergenic
1194243094 X:91475785-91475807 CTATTACTGTCTATCTCAATAGG - Intergenic
1195543168 X:106086462-106086484 TTAATCCAGTCTATCCCTATTGG - Intergenic
1197631575 X:128867151-128867173 CTAGTTCACTCTATTTCTGAAGG - Intergenic
1197943728 X:131816244-131816266 CTAGTTCAGGCCTTCTCTTTCGG + Intergenic
1199397897 X:147361184-147361206 CTAATCCAGTCTATCGCTGTTGG + Intergenic
1201916340 Y:19185503-19185525 TTAATTCAGTCTATCATTATTGG + Intergenic