ID: 967319776

View in Genome Browser
Species Human (GRCh38)
Location 3:188184037-188184059
Sequence GGACCACGGTACCTCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967319771_967319776 2 Left 967319771 3:188184012-188184034 CCAGTTGCTGGAGGTGTTCAGGC 0: 1
1: 0
2: 2
3: 22
4: 198
Right 967319776 3:188184037-188184059 GGACCACGGTACCTCCTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967319776 Original CRISPR GGACCACGGTACCTCCTTGT GGG Intronic
913164749 1:116174782-116174804 GGACTACGTTATCTCCCTGTAGG - Intergenic
915936897 1:160094977-160094999 GCACCACGGCATCACCTTGTAGG + Exonic
916482941 1:165232033-165232055 GCACCATGGCACATCCTTGTGGG - Intronic
918216958 1:182400170-182400192 GGACCAGGGTACCTTTTTCTAGG + Exonic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067346562 10:45442562-45442584 GGACCAGGATCCCTCCTTGTGGG + Intronic
1067878965 10:50027255-50027277 GGACCACGGTGATGCCTTGTGGG + Intergenic
1069675854 10:70246865-70246887 CGACCATGGTACCTGATTGTAGG + Intergenic
1070483493 10:76908357-76908379 GGACCATTTTATCTCCTTGTTGG + Intronic
1071290008 10:84181856-84181878 GGACCACAGTACTTCCTGGCTGG - Intronic
1080998984 11:37644042-37644064 GGACCACTGTAACTCCTTTCTGG - Intergenic
1106594618 13:31125688-31125710 GGAGCATGGTCCCTCCTTGATGG - Intergenic
1108057581 13:46499795-46499817 GGACCACAGTACCTCTTTGGAGG - Intergenic
1113311853 13:109140363-109140385 GGACCCCGATATCTCCTCGTAGG - Exonic
1117801863 14:59452642-59452664 GCAACATGGTACCTCCATGTTGG + Intronic
1127772767 15:62244228-62244250 GGCCCACTGTACTCCCTTGTTGG - Intergenic
1132233489 15:100201610-100201632 GGGCCCAGGTACCTCATTGTGGG + Intronic
1135597843 16:23756819-23756841 GGAGCCAGGTAACTCCTTGTTGG - Intronic
1142295784 16:89221145-89221167 GGCCCACGGTAAGTCCTGGTGGG + Exonic
1151430889 17:74062012-74062034 GGACCGTGGTACCTACTTTTTGG + Intergenic
1153836513 18:8969053-8969075 GGACGCCAGTCCCTCCTTGTGGG - Intergenic
1155434131 18:25793426-25793448 GGTCCACTGTACATCATTGTTGG + Intergenic
1160188895 18:76698370-76698392 GGAGCAGGGGACCTCCTTGCAGG + Intergenic
1160392899 18:78548207-78548229 GGACCAGGGTTCCTCCATGCTGG - Intergenic
1165755959 19:38293107-38293129 GTACCCCAGGACCTCCTTGTTGG - Intronic
943868428 2:192959320-192959342 GGAACAAGGTACCACCTTGAAGG + Intergenic
1177106777 21:16966761-16966783 GGACCATGGCAGCTGCTTGTAGG - Intergenic
1184423742 22:44396811-44396833 GGACCATGGAGCCTCTTTGTAGG - Intergenic
965827864 3:172748975-172748997 GGACTATGATACCTACTTGTGGG + Intergenic
967319776 3:188184037-188184059 GGACCACGGTACCTCCTTGTGGG + Intronic
969242471 4:5909225-5909247 GGACCACATGACCTCCTTGCAGG + Intronic
991454556 5:66788663-66788685 GGAAGAAGGTACCTCCCTGTTGG - Exonic
993560993 5:89408315-89408337 GGCACACTGTACCTTCTTGTTGG + Intergenic
1003190075 6:3866890-3866912 GGACCACAGTTCTTCCTTCTTGG + Intergenic
1006801020 6:36759694-36759716 GGTCCACGGAGCCTCCCTGTGGG - Intronic
1011764833 6:90609675-90609697 GAACCACAGTACCACCTTGTGGG - Intergenic
1018390831 6:163340694-163340716 GGATGACAGTACTTCCTTGTAGG - Intergenic
1023887389 7:44368766-44368788 GCACCACTGTAGCTGCTTGTAGG + Intergenic
1024248768 7:47490665-47490687 GCACCTCGGTGCCCCCTTGTAGG - Intronic
1030227399 7:107168873-107168895 GGACCACGGTACCACCCAATGGG + Intergenic
1033169844 7:139073832-139073854 TGAGCACTGTTCCTCCTTGTAGG - Intronic
1036643887 8:10600522-10600544 TCACCACGGAAGCTCCTTGTTGG - Intergenic
1036762534 8:11519252-11519274 GGACCTCGCTACCTTCATGTGGG + Intronic
1052706205 9:31996507-31996529 AGACCACAGTGCCTCCTGGTGGG + Intergenic
1057713569 9:97469130-97469152 AGACCACGTTACCTCCATTTTGG + Intronic
1060014819 9:120078070-120078092 GGACCATGGTAACTCCTTTAAGG - Intergenic
1060934702 9:127508313-127508335 GGACCATGGCGCCTCCTTGCAGG + Intronic
1193693579 X:84679718-84679740 GCACCATGGTAGCTTCTTGTAGG - Intergenic
1194198662 X:90928627-90928649 GGAACAAGGTAACTCATTGTGGG + Intergenic
1197596685 X:128472126-128472148 ATACCAAGGTACCTCCTTGTAGG - Intergenic