ID: 967320951

View in Genome Browser
Species Human (GRCh38)
Location 3:188194556-188194578
Sequence TTTCCTAGGAAAAAGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 497}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967320951_967320958 20 Left 967320951 3:188194556-188194578 CCTAGTTTCTTTTTCCTAGGAAA 0: 1
1: 0
2: 5
3: 43
4: 497
Right 967320958 3:188194599-188194621 TGTAGTTCTTGAGGGAAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 283
967320951_967320957 19 Left 967320951 3:188194556-188194578 CCTAGTTTCTTTTTCCTAGGAAA 0: 1
1: 0
2: 5
3: 43
4: 497
Right 967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 268
967320951_967320955 11 Left 967320951 3:188194556-188194578 CCTAGTTTCTTTTTCCTAGGAAA 0: 1
1: 0
2: 5
3: 43
4: 497
Right 967320955 3:188194590-188194612 CACAACTTCTGTAGTTCTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 111
967320951_967320956 12 Left 967320951 3:188194556-188194578 CCTAGTTTCTTTTTCCTAGGAAA 0: 1
1: 0
2: 5
3: 43
4: 497
Right 967320956 3:188194591-188194613 ACAACTTCTGTAGTTCTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967320951 Original CRISPR TTTCCTAGGAAAAAGAAACT AGG (reversed) Intronic
900896533 1:5486854-5486876 ATTTCTAGGAAAAATGAACTCGG + Intergenic
903934955 1:26889260-26889282 TTTCCTGGGAGAAGGAAACCAGG - Intronic
904123131 1:28216263-28216285 TTCCCAAGGAGAAAGGAACTGGG + Intronic
904228662 1:29047552-29047574 TTTCCTAGAAAAACACAACTAGG - Intronic
905076460 1:35275922-35275944 TTTCCTAAGTACAAGAAAGTGGG - Intronic
905853604 1:41292362-41292384 TTTCCTAGCAAAAAGATCTTGGG + Intergenic
906784430 1:48602211-48602233 TTTCCTAGGAAGAAAAATCCTGG - Intronic
908009173 1:59758218-59758240 TTACCTGGGAAAAAGAACATTGG - Intronic
908198140 1:61766307-61766329 TTTCCTAGAAAAATCAAAGTTGG - Exonic
908247070 1:62235934-62235956 TTTACCAGGAAAAGCAAACTGGG - Intergenic
908428439 1:64031990-64032012 TTTCCTAGGAAAAGAAACCAGGG - Intronic
908983746 1:69991230-69991252 TTTCCTTTAAGAAAGAAACTAGG + Intronic
909426985 1:75536691-75536713 TTTGCTAGTAAAAAGAAAATGGG - Intronic
909996885 1:82290717-82290739 TTTACAAAGAAAAAGAAATTGGG - Intergenic
910375297 1:86562359-86562381 TTTCCTAGGCAAATGGAACCAGG - Intronic
910606599 1:89092101-89092123 TTACAGAGGAAAAAGAAAATTGG + Intergenic
910664277 1:89707504-89707526 TTTCCATGGAAGCAGAAACTGGG - Intronic
911375233 1:97043897-97043919 GTTCACAGGAAAGAGAAACTGGG + Intergenic
911424944 1:97696540-97696562 TTTCCTAAGCACAACAAACTTGG - Intronic
911768383 1:101707557-101707579 CTTCCTAGGAAAAATATACGTGG + Intergenic
913481043 1:119289502-119289524 TTTCCAGGAAAAAAGAAAGTGGG - Intergenic
916196644 1:162230072-162230094 TGTCCAAGGAAGAATAAACTAGG + Intronic
918886411 1:190199817-190199839 TTCCCTAGAAAAAAGAAAAATGG - Intronic
919087933 1:192943546-192943568 TTTCCAAAGAAAAAGAGATTTGG + Intergenic
919286416 1:195567438-195567460 TTTCCTTGGAAACAGGTACTGGG + Intergenic
920388311 1:205583055-205583077 TTTCCTAAGTGAAAGGAACTGGG + Intronic
921384368 1:214553646-214553668 TTTTCTAGTGAAAAGACACTAGG + Intergenic
921816713 1:219572317-219572339 TTTCCTAAGAAAAAGTAGCAGGG - Intergenic
922431378 1:225558045-225558067 ATTCCTAGGATAAACAATCTTGG + Intronic
922805551 1:228386375-228386397 TTTGCTAGGAATAAGATTCTTGG - Intergenic
923013889 1:230110754-230110776 TTTTCTGGTAAAAAGAGACTGGG + Intronic
1063180484 10:3594044-3594066 TTTCCTAGAATAAAAAAATTTGG + Intergenic
1063194821 10:3731490-3731512 ATTCATAGGAAATAGAGACTTGG + Intergenic
1063808423 10:9675515-9675537 TTTCGAATGAAACAGAAACTTGG - Intergenic
1063878855 10:10510070-10510092 TTTCCAAGGAAAAAGGAGCAGGG - Intergenic
1063933704 10:11055434-11055456 ATTCCCAGGAAAATGATACTCGG - Intronic
1064127303 10:12674409-12674431 TTTCCTAGGAAACAGCATCGTGG + Intronic
1065452781 10:25876130-25876152 CCTCCTAGGAAATAGAAGCTAGG - Intergenic
1065952468 10:30664737-30664759 TTTCATATCAAAAAGAAAATTGG + Intergenic
1066280239 10:33910159-33910181 CTTTCTATCAAAAAGAAACTTGG - Intergenic
1066347631 10:34604165-34604187 TTTCGGAGGAGAAGGAAACTGGG + Intronic
1067071485 10:43135822-43135844 TTTACTAGGAAAATGAGTCTAGG + Intergenic
1067689456 10:48492104-48492126 TTTCATAAGAAAAAGAAAAAAGG + Intronic
1067970820 10:50968430-50968452 TTTCCTAGGAGACAGAAATTGGG + Intergenic
1068027910 10:51671450-51671472 ATTGCTGGCAAAAAGAAACTAGG - Intronic
1068123238 10:52806281-52806303 GTCCCTGGAAAAAAGAAACTTGG - Intergenic
1069576636 10:69535183-69535205 TTTCCTATGAAAAATAAACCAGG + Intergenic
1069888722 10:71639650-71639672 TTTTCTTGGAGAAAGAAACTGGG - Intronic
1070471126 10:76780533-76780555 TAACCTAGGAAAAGGAAGCTCGG - Intergenic
1071214272 10:83380791-83380813 TTTCCTAAGAAAAGAAAATTTGG - Intergenic
1071586594 10:86828832-86828854 TTTACTTGGAAAAAGAAAGAGGG + Intronic
1071788226 10:88926878-88926900 AATCCTACTAAAAAGAAACTAGG - Intronic
1072484842 10:95845258-95845280 TTTCCTAAGGCAAAGAAACAGGG - Intronic
1074350331 10:112730531-112730553 ATACATAGGAAAAAGAAACTCGG - Intronic
1075864453 10:125705748-125705770 TTTCTAAGGAAAAAGAAAACTGG - Intergenic
1076160890 10:128243359-128243381 TTTCCTAGGAAACAGGAAGAAGG + Intergenic
1078210033 11:9263533-9263555 TTTCTTATGAAAAAAAAATTAGG - Intronic
1078378121 11:10813839-10813861 AATCCCAGGAAAAGGAAACTGGG + Intronic
1078475774 11:11628608-11628630 TTTCCTATACAATAGAAACTGGG + Intergenic
1079539285 11:21552426-21552448 TTTCCAAGGAAAACCAAAGTAGG - Intronic
1080486012 11:32707459-32707481 TTTCCCAGGAAAAAACAAATAGG - Intronic
1080580520 11:33639144-33639166 TTTTTTAGGAAGAAGATACTTGG + Intronic
1080901666 11:36499273-36499295 TATCCTCAGAAAAAGAAAATGGG + Intronic
1081074167 11:38648405-38648427 AATCCTATGAAATAGAAACTGGG - Intergenic
1081094089 11:38910176-38910198 TTTCCTTGGAAAACAAAATTTGG - Intergenic
1082251523 11:49986698-49986720 TTTCCTTAGAAACAGAAATTTGG + Intergenic
1084386861 11:68848834-68848856 TTTTCTAGGGAACAGTAACTTGG + Intergenic
1085161367 11:74349582-74349604 TTTCCTAGTAAAAGGAACCAGGG - Intronic
1085421145 11:76361608-76361630 TTTATTCAGAAAAAGAAACTGGG - Intronic
1086091707 11:83011242-83011264 GTACATGGGAAAAAGAAACTAGG - Intronic
1086588929 11:88488611-88488633 TTTCCAAGCAAATAGAAAGTAGG - Intergenic
1086752465 11:90514530-90514552 TGTCTTATGAAAAAGAACCTGGG - Intergenic
1087257997 11:95978625-95978647 TTTCCAGGGAAAAAGAAACTTGG + Exonic
1087581670 11:100063402-100063424 GTTCCTTAGAAAGAGAAACTGGG + Intronic
1088569498 11:111208199-111208221 ATACATAGGAAAAAGAAATTTGG + Intergenic
1089000311 11:115046298-115046320 TTTTTTTAGAAAAAGAAACTGGG + Intergenic
1089063084 11:115642278-115642300 TTTCCTGGGAAAAAAAAATCTGG + Intergenic
1089358221 11:117869638-117869660 CTTTCTAGGGAAGAGAAACTTGG + Intronic
1089566689 11:119375493-119375515 CTTTCTAGGAAAAGGTAACTGGG + Intronic
1089923738 11:122235434-122235456 ATTCAGAGGGAAAAGAAACTGGG + Intergenic
1090239683 11:125173311-125173333 TTTTATAGGTAAGAGAAACTGGG + Intronic
1091005182 11:131946767-131946789 TCTTCTAGGTAAAAGAAACAAGG - Intronic
1091175536 11:133554384-133554406 TTTCCTTGGAAAGAAAAGCTTGG + Intergenic
1091637723 12:2210456-2210478 CCTCCTAGGAAAGAGAAACAAGG - Intronic
1091811479 12:3402234-3402256 TTTCCTAGTTAATAGGAACTGGG + Intronic
1091856280 12:3742945-3742967 TGTACTAGGAAAAAGAAAAAGGG - Intronic
1091874538 12:3923006-3923028 TCTACAAGGAAAAGGAAACTAGG - Intergenic
1094437780 12:30440522-30440544 TTTCCTAGGACAAGAAAACTGGG - Intergenic
1096763280 12:53861612-53861634 TGTCCCAAGAAAAAGAAAATGGG + Intergenic
1097429281 12:59484062-59484084 ATTCCTTGCTAAAAGAAACTAGG - Intergenic
1097792762 12:63832335-63832357 TTTAGTAGGAAAAAGAGAATGGG - Intergenic
1097952424 12:65446723-65446745 TTTCCCAAGAAAAAAAAAATGGG + Intronic
1098062885 12:66581768-66581790 TTTCCAACGAAAAAGAATCCAGG + Intronic
1098149925 12:67536223-67536245 TTACAGAGGAAAAAGAAACATGG + Intergenic
1099273898 12:80550790-80550812 TTTCCTATGAAGAATAAACAAGG - Intronic
1102418337 12:112783944-112783966 TTTCCAGGGAAAAGCAAACTAGG + Intronic
1102849661 12:116228560-116228582 TTTCTTAGGAAAGAGGAAGTGGG - Intronic
1104453213 12:128888322-128888344 TTTCCTAGGAATGATAAGCTTGG + Intronic
1105427327 13:20305569-20305591 TTTCCCAGCAAAATGAAACAGGG + Intergenic
1106016340 13:25872563-25872585 TTTCCTTGGGTAAAGAAGCTGGG - Intronic
1106055174 13:26230687-26230709 GTTCCTAGGAACAAGAAAGATGG - Intergenic
1106102522 13:26707274-26707296 TTTGCTAGAGAAAAGAAAGTAGG + Intergenic
1107085513 13:36423999-36424021 TCTCCTAGTAAAAAGAAGCCTGG + Intergenic
1107168651 13:37314059-37314081 TTCCCCAGGAAAAACAACCTGGG + Intergenic
1107945326 13:45412997-45413019 TCTCCTGGGAAAAGGAGACTTGG - Intronic
1108605990 13:52039109-52039131 TTTCCTAAGAAAAAGAAGATAGG + Intronic
1108932189 13:55839053-55839075 TTTCCTTAGAAAAAAAAATTAGG + Intergenic
1110067014 13:71121243-71121265 TTTTCTAGAAAGTAGAAACTGGG + Intergenic
1110075441 13:71235141-71235163 TTTCCATTTAAAAAGAAACTGGG - Intergenic
1110177941 13:72579730-72579752 TTTACAAGGAAAAGGAACCTTGG - Intergenic
1110233294 13:73189665-73189687 TTAACTAAGAAAAAGAAAATGGG - Intergenic
1110476821 13:75925582-75925604 TTACTTAGAATAAAGAAACTAGG - Intergenic
1110560220 13:76903417-76903439 TTCCTTAGGTAATAGAAACTGGG + Intergenic
1111007050 13:82261758-82261780 TTTCCTAGGGAGAAGAAGCTTGG + Intergenic
1111342283 13:86902346-86902368 TTTCCTTAGGAAAAAAAACTTGG + Intergenic
1111625410 13:90778281-90778303 TTTCCAAGGACAAAGAAAAGAGG + Intergenic
1111796843 13:92932323-92932345 TTTCCTAGACAAAATAAAATTGG + Intergenic
1112079503 13:95953722-95953744 TTTTCTACAAAAAAAAAACTTGG + Intronic
1112167555 13:96935869-96935891 TTTCCTAGGAGAGGGAAAGTAGG - Intergenic
1112187888 13:97145468-97145490 TGTCCAAGGAAAAAGAACCTAGG + Intergenic
1112398555 13:99055887-99055909 ATTCCTAGGCCAAAGAATCTGGG + Intronic
1112732227 13:102377086-102377108 TTTCTTAGGAAAAAAAAAAAAGG - Intronic
1113151047 13:107263830-107263852 TTTCCTAGGAAAATTATCCTAGG + Intronic
1114397617 14:22381054-22381076 ATTCGGAGGAAATAGAAACTTGG - Intergenic
1114864414 14:26571184-26571206 TTACCTAGGATTTAGAAACTAGG + Intronic
1115246154 14:31298048-31298070 TATCCTAGGTAAAAGAGAGTAGG - Intronic
1115829478 14:37319242-37319264 TTTCCTTGAAGAAAGAAACATGG - Intronic
1116691445 14:48111915-48111937 TGACCTAGGAAAAAGAAATATGG - Intergenic
1116976050 14:51117189-51117211 ATTGCAAGGATAAAGAAACTTGG + Intergenic
1117163607 14:53012638-53012660 TTTCATAGGAGAAAACAACTTGG + Intergenic
1117258894 14:54008366-54008388 TTTCCTTAGAAAAAGAAAGGAGG - Intergenic
1117750742 14:58921034-58921056 TTTCCTTGGATAAAAAAACTAGG - Intergenic
1117864377 14:60130397-60130419 TTTCATAGTAAAAACAAAATAGG + Intronic
1118042830 14:61936136-61936158 TTTGATTGGAAAAAGGAACTCGG + Intergenic
1118512722 14:66493342-66493364 TTTTCCAGTAAAAAGAAACATGG + Intergenic
1118710343 14:68513617-68513639 TTTCCAAAGTAAAAGACACTGGG - Intronic
1118939146 14:70316623-70316645 TTCACTAGGAAAAAAAATCTAGG - Intergenic
1120534680 14:85679786-85679808 TTATCTAGGGAACAGAAACTGGG + Intergenic
1120774999 14:88424309-88424331 TTTCCAAGGAAAGAAAAAATAGG + Intronic
1121808501 14:96856565-96856587 TTTCCTGAGAAAAACAAACCAGG + Exonic
1122403399 14:101481093-101481115 TTTCCTAAGCTAAACAAACTGGG - Intergenic
1125307405 15:38335099-38335121 TTTCATAGGAAAATAAAATTGGG + Intronic
1126052229 15:44696508-44696530 TTTCCCAGTAAAAACAAATTTGG + Intronic
1126239317 15:46423692-46423714 ATACCTAGGAAAATAAAACTGGG - Intergenic
1126896759 15:53266045-53266067 TTTCCTAGGAAAATAAAAATAGG + Intergenic
1127633302 15:60846125-60846147 TGTCCTAGGGAAATGAATCTTGG + Intronic
1128170957 15:65512550-65512572 TTTTCTAGGAAAATGCAACATGG - Exonic
1128573849 15:68756069-68756091 TTTCTTAGGAAAAAGATTCTTGG - Intergenic
1129149630 15:73679997-73680019 ATTCCCAGGACTAAGAAACTAGG + Intergenic
1129718464 15:77865123-77865145 TTTCCTGGGAAGAGGAGACTCGG + Intergenic
1129890065 15:79065996-79066018 TTTCCTAGGAAACAGATAACTGG + Intronic
1130460457 15:84155743-84155765 TTTCCTGGGAAAAGGAGGCTTGG - Intergenic
1130628567 15:85541546-85541568 TTTCCTAGCAAAAAGAAACAGGG + Intronic
1130640164 15:85665416-85665438 TTTCCTACAAAGGAGAAACTTGG - Intronic
1131218688 15:90562480-90562502 TTTCCTAGGTAAAAACAAATTGG - Intronic
1131454602 15:92573307-92573329 TTCACTTGGAAAAAGAAACACGG + Intergenic
1131500541 15:92960591-92960613 TATGCTAGGAAAAAAAAAGTTGG - Intronic
1131764557 15:95661350-95661372 TGACCAAGGCAAAAGAAACTTGG + Intergenic
1131791929 15:95974298-95974320 TTTCCTAGAAAAAAAAACCTAGG - Intergenic
1135781213 16:25302690-25302712 TTTCTTAGGAAAATAAAATTAGG - Intergenic
1138414606 16:56864457-56864479 TTTCTTTGGAAGCAGAAACTGGG - Intergenic
1139185932 16:64806099-64806121 ATCCCCAGGAAAAATAAACTGGG + Intergenic
1140796574 16:78444048-78444070 TTTCCTAGCAAAAACAAAGAGGG + Intronic
1141300122 16:82807318-82807340 TTTTCCAGGCAAAAGAAAATAGG + Intronic
1142294685 16:89212734-89212756 TTTCTTTGGAAAAATAGACTGGG - Intergenic
1142870287 17:2815312-2815334 TATCCTCAGACAAAGAAACTGGG - Intronic
1144476819 17:15595851-15595873 TTTCCTAAGAAGAAAACACTGGG - Intronic
1144921425 17:18767497-18767519 TTTCCTAAGAAGAAAACACTGGG + Intronic
1145055260 17:19699188-19699210 TTTCTTGGAAAAAAAAAACTAGG - Intronic
1145093598 17:20005833-20005855 TTTCTGAGGAAAAATAAACCAGG + Intergenic
1146329980 17:31918734-31918756 TTTCCAAGAAAAAACAAAATAGG - Intergenic
1146649399 17:34597410-34597432 ATTCCTAGGAAAAAGATCTTAGG + Intronic
1146723249 17:35137876-35137898 TTTCTTAGGACACAGACACTGGG - Exonic
1147221505 17:38934861-38934883 TTTCCTTAGAGAAAGAAATTTGG - Intergenic
1147622956 17:41880207-41880229 TTTCCTATAAAAAAGGAAATGGG + Intronic
1148137770 17:45306174-45306196 TTTACAAGGAGGAAGAAACTGGG + Intronic
1148726738 17:49797446-49797468 TGTAATAGGAAAAAGAGACTGGG + Intronic
1150930860 17:69583599-69583621 TTTTTTTGGAAAAAGAAAGTAGG + Intergenic
1152288013 17:79423631-79423653 ATTCCTGGGAAAAAGCAAATGGG - Intronic
1153346546 18:4032481-4032503 TTTTCAAGGACAAAGAAACCTGG - Intronic
1153368965 18:4292378-4292400 TTTCAAATGAAAAAAAAACTTGG - Intronic
1153404707 18:4724053-4724075 TTACCTAGGTAAAGGAATCTGGG + Intergenic
1153581599 18:6579431-6579453 TTTTCTAGGTATATGAAACTAGG + Intronic
1153851390 18:9098678-9098700 GTTCCTAGGTAATAGAAATTGGG + Intergenic
1154387095 18:13904036-13904058 TTTCGTTGGAAGAAGAAACAGGG - Intronic
1155279087 18:24219870-24219892 TATACTAGGAAGAAGAAACAAGG - Intronic
1155674000 18:28407634-28407656 TCACCTAGGAAAAAGAAAGAAGG - Intergenic
1156654855 18:39272920-39272942 TTTCTTAGATAAAAGAAACTTGG + Intergenic
1157046314 18:44105240-44105262 TTTAAAAGGAAAAAGTAACTAGG - Intergenic
1157573325 18:48728004-48728026 TTACCTAGCAAGAAGAAACCAGG + Intronic
1158169491 18:54580914-54580936 TTTCCTAGAAAAAAAAATCTAGG + Intergenic
1158283941 18:55857832-55857854 ATTCTTAACAAAAAGAAACTGGG - Intergenic
1158388545 18:57022509-57022531 TTTCTTAGCAGAAAGAAAGTTGG - Intronic
1159796478 18:72850552-72850574 TTTCTTAGGAAAAATATACAGGG + Intronic
1160220027 18:76968494-76968516 ACTCATAGGAAAAAAAAACTAGG + Exonic
1160271533 18:77389409-77389431 ATTTCTATGAAAAAGATACTGGG + Intergenic
1161147193 19:2685958-2685980 TGTCCTTGGAAAGTGAAACTGGG - Intronic
1161711355 19:5850243-5850265 TTTTCTAGGAAAAAATATCTTGG - Intronic
1163773462 19:19204506-19204528 TTTTCTGGGAAAGACAAACTTGG - Intergenic
1164924197 19:32114167-32114189 TTTCAGAGGAAAGAGAAACTTGG - Intergenic
1165602048 19:37062519-37062541 CTTCATAGGAAAAACAAATTAGG - Intronic
1166410472 19:42553037-42553059 TCTCCCAGGAAAGAGAGACTGGG + Intronic
1166423940 19:42659140-42659162 TGTACTGGGTAAAAGAAACTTGG - Intronic
1167736755 19:51299295-51299317 TGTCCTAGGAAACAGAGAGTCGG + Intergenic
1168126734 19:54288123-54288145 TTTCCCAGGAAAATGAGAATGGG + Intergenic
925193177 2:1901960-1901982 TTTTCTTTGAAAAAGATACTTGG - Intronic
925791422 2:7491715-7491737 CATCTTAGGAAACAGAAACTGGG - Intergenic
926546099 2:14242177-14242199 TTTACATGGAAAAAGAATCTTGG + Intergenic
926626384 2:15093985-15094007 TCTCTTAGTAACAAGAAACTAGG - Intergenic
927800378 2:26093623-26093645 TTTACCAGGAAAAGAAAACTGGG + Intronic
928079840 2:28301101-28301123 TTTCACAGGACAAAGAAACAGGG - Intronic
928092628 2:28384935-28384957 TTCCCCATGGAAAAGAAACTAGG - Intergenic
928496149 2:31834199-31834221 CTTCCTATGAGACAGAAACTTGG - Intergenic
928748267 2:34441347-34441369 TTTTCTAGGAAATACAAGCTAGG + Intergenic
928905649 2:36364616-36364638 TGTTTTAGGAAAAAGAAAATAGG + Intronic
929574912 2:43045376-43045398 TCTCAAAGGAAAAAGAAAGTTGG - Intergenic
929644046 2:43609776-43609798 CTTCCTAGGAAACAGATTCTAGG + Intergenic
929936473 2:46297599-46297621 TTTCCAGGGAAAAAGGAACTTGG + Exonic
929979611 2:46666262-46666284 TTTCCTGAGAAAGACAAACTTGG + Intergenic
930533895 2:52623277-52623299 TTTACTAGAAAAAATAAATTAGG + Intergenic
932513498 2:72320133-72320155 TTTCTTAAGAAAAAAAAGCTTGG - Intronic
932529847 2:72517442-72517464 TTTTCTAGGAAGGAAAAACTCGG - Intronic
932638722 2:73419115-73419137 TTTTCTAGAAAACAGAATCTTGG + Exonic
933038349 2:77429354-77429376 TATCCAAAGAAAAAGAAAATTGG + Intronic
933215382 2:79624105-79624127 TTTGCTATGAAAAAGAAAATGGG - Intronic
933369129 2:81393118-81393140 TTAGCTACGGAAAAGAAACTTGG - Intergenic
933757875 2:85654417-85654439 TTTACGAGTAAAAATAAACTAGG - Intergenic
933912229 2:86951793-86951815 TATCCTAGGGATAAGAAGCTTGG + Intronic
934010765 2:87818104-87818126 TATCCTAGGGATAAGAAGCTTGG - Intronic
935774333 2:106458805-106458827 TATCCTAGGGATAAGAAGCTTGG - Intronic
935905735 2:107837108-107837130 TATCCTAGGGATAAGAAGCTTGG + Intronic
935992217 2:108729637-108729659 TATCCTAGGGATAAGAAGCTTGG + Intronic
936426306 2:112423779-112423801 TATCCTAGGGATAAGAAGCTTGG - Intronic
937276857 2:120690484-120690506 TTTCCTTGGAAAACGTCACTGGG + Intergenic
937688997 2:124732692-124732714 TTTCTTATGAAAAATAAATTTGG - Intronic
937710220 2:124972164-124972186 TTTCCTGGGAATCAGAAACTGGG + Intergenic
939368093 2:141261147-141261169 TTTACTAGGCCAAAGAAACAGGG - Intronic
939944428 2:148392275-148392297 TTTATTAGCAAAAATAAACTGGG + Intronic
939968962 2:148639131-148639153 TTTCCTAGTAACACGAAATTAGG - Intergenic
940519464 2:154725523-154725545 ATTTCTAGGAAAAAAACACTGGG - Intronic
940663524 2:156577147-156577169 TTTCCTAAGAAAAGGAAAGCAGG + Intronic
941021192 2:160408643-160408665 TTTCTTAGGACACAGAAACTCGG + Intronic
941746244 2:169089700-169089722 TTTCCTAGGAGAATCAAACTTGG - Intronic
942015750 2:171812937-171812959 TTTCCTGTGAAAAAGAATCCAGG - Intronic
942486411 2:176444430-176444452 TGTTCTAAGAAAAAGTAACTAGG - Intergenic
942609868 2:177732232-177732254 TTCCCTAAGAAAAATAAACATGG - Intronic
942635067 2:177994723-177994745 TTTCTTAAGTAAAAGAAAATGGG - Intronic
942638125 2:178030989-178031011 ATTCCTAGGAAACATCAACTTGG - Intronic
942861426 2:180617668-180617690 TTTCATAGGAAACAGAAACAAGG + Intergenic
943545185 2:189267489-189267511 TTGCCTAAGAAGAAGAAAATAGG + Intergenic
943784874 2:191866354-191866376 CTTCCTCGGATAAAGAATCTTGG + Intergenic
943899744 2:193418288-193418310 TATCCTAAATAAAAGAAACTAGG - Intergenic
944056749 2:195530044-195530066 ATTCCTTGAAAAAAGAAATTTGG + Intergenic
944291176 2:198006888-198006910 CTTCCTAGGAAAATGAAAGCAGG - Intronic
944655463 2:201872772-201872794 TTTACTTTGCAAAAGAAACTAGG - Intronic
944836491 2:203585343-203585365 TTTACTAGGACAAAGATACCAGG - Intergenic
945378335 2:209107218-209107240 TTTCCTAGTAAAGAAAAGCTTGG + Intergenic
946592060 2:221261458-221261480 TTTCATAGGATGTAGAAACTGGG - Intergenic
946665574 2:222046371-222046393 TTTCCTAAGAAGAAGACATTCGG + Intergenic
946667274 2:222064228-222064250 TTGCTTAGGAAACAGAAATTTGG + Intergenic
947142058 2:227028483-227028505 TTCCCTGAGAAAATGAAACTGGG - Intronic
947477819 2:230467032-230467054 TATTCTATGAAAAGGAAACTAGG - Intronic
948344763 2:237286396-237286418 TTTCCTAAAAAAATGAAACATGG - Intergenic
1169460817 20:5793211-5793233 ATTCCGAGGAAAAAAAAAGTTGG - Intronic
1169715389 20:8611037-8611059 TTTTCTAGGAAAATCAACCTAGG + Intronic
1170539296 20:17371946-17371968 TTTCCTGGAAAAAAGAAAACAGG + Intronic
1170698219 20:18679606-18679628 TTACCTACCAAAAAGAATCTAGG - Intronic
1171164959 20:22961627-22961649 TTTCCATGGAAAAAGTCACTAGG - Intergenic
1172408776 20:34707471-34707493 TTTTCTGGGAAAAAGGACCTTGG - Intronic
1172769683 20:37374008-37374030 TTGCCTAGTTAAAAAAAACTTGG + Intronic
1173217401 20:41098196-41098218 TTTCCTAGTCAAAAGAAAATGGG - Exonic
1174600361 20:51719431-51719453 TTTCCTAAAAAGAAGAAACATGG + Intronic
1174753890 20:53139376-53139398 TTTCCTTGAAGAAAGAGACTGGG + Intronic
1174891584 20:54400850-54400872 ATGCCCAGGAAAAACAAACTTGG - Intergenic
1175826094 20:61937443-61937465 TTTATTAAGAAAAAGAAAGTGGG + Exonic
1177458273 21:21372718-21372740 TTTCCTAGGAATCACACACTTGG + Intronic
1178034567 21:28564973-28564995 TTTCCAAAAAAAAAGAAAATAGG + Intergenic
1178744824 21:35238940-35238962 TTTCCTTTGATAAAGAAACTTGG - Intronic
1179209107 21:39311172-39311194 TTTTTTAAAAAAAAGAAACTAGG + Intronic
1179527150 21:41987642-41987664 TTTCTTAGTAAAAAGTAATTAGG - Exonic
1180327500 22:11443744-11443766 ACTCCTAGGGAAAAGAAATTTGG - Intergenic
1183003100 22:34877860-34877882 TTCCCTAGGAAAGACAAACAAGG - Intergenic
1184753818 22:46504871-46504893 TGTTATATGAAAAAGAAACTTGG + Intronic
949211632 3:1510171-1510193 TTGGCTAGGGAAATGAAACTGGG + Intergenic
949523138 3:4875499-4875521 TTTGTTAGGAATAAGAAAATTGG + Intronic
949647792 3:6117701-6117723 TTTCCTAGGAATTGGAAACTTGG + Intergenic
949657960 3:6243197-6243219 AGTCCTATGAAAAAGAACCTGGG + Intergenic
949712419 3:6886892-6886914 TGTCCTCTGAAAAAAAAACTTGG - Intronic
950300386 3:11872285-11872307 TTTCCTAAGATGAAAAAACTCGG - Intergenic
950340754 3:12241944-12241966 CTTCCTAAGAAAAAGTAAGTGGG + Intergenic
951098927 3:18664061-18664083 TTTCATAGCAGAAAGAAACATGG - Intergenic
951463493 3:22976923-22976945 TATCCAAGGAAAAACAAACTTGG + Intergenic
951989808 3:28664140-28664162 CTTTCTAGGAATAAGAAACAAGG - Intergenic
952534389 3:34294754-34294776 CTTCCTAGGAAAATATAACTAGG + Intergenic
953322173 3:41982725-41982747 TTTCCTAGGCAAAGGACCCTGGG + Intergenic
955134266 3:56200367-56200389 TTTCTTAGTAAAAAGATACTAGG - Intronic
955700106 3:61673828-61673850 TGTGGTAGGAAATAGAAACTTGG + Intronic
956065060 3:65389220-65389242 TTCACTAGGAAAAAAAAATTAGG - Intronic
956201981 3:66716055-66716077 TTTCCTTGGGATAAGAAAGTTGG - Intergenic
956687200 3:71840973-71840995 TTTTATAAGAAAAAGAAATTTGG + Intergenic
957949806 3:87109906-87109928 TTTCCTAATAAAAAGAAAGAGGG - Intergenic
957986700 3:87581120-87581142 TTTCTTAGGCAGTAGAAACTGGG - Intergenic
958684355 3:97374033-97374055 TTTCCTAAGAAAAATAAAATTGG - Intronic
959360545 3:105385173-105385195 TTTCCATGGAAATAGAATCTAGG + Intronic
959518924 3:107303787-107303809 ATCCCTAGAAGAAAGAAACTGGG - Intergenic
959661145 3:108869322-108869344 TCTCCTAGGAAAGAGGAACAGGG - Intergenic
960107607 3:113814821-113814843 CTTCTTAAGAAAAACAAACTGGG - Intergenic
960525217 3:118702081-118702103 TCTCCAAGAAAAAAGACACTTGG + Intergenic
962253495 3:133854135-133854157 GTTCCTAGGGCAAAGAAGCTGGG - Intronic
962788109 3:138785894-138785916 TTTCATAGTAACAAAAAACTAGG + Intronic
962817365 3:139013933-139013955 TTTCCTAGAAAAAACAAAGCTGG - Intronic
963149469 3:142030407-142030429 TTTGAAAGAAAAAAGAAACTTGG + Intronic
963256632 3:143151633-143151655 TTTCCCAGAGAAAAGAAATTTGG + Intergenic
963597506 3:147346844-147346866 TTTGCTAGGAAACTGAAAATAGG + Intergenic
964383943 3:156127247-156127269 TTTTCTAGGAAAAAAAATATTGG - Intronic
964442055 3:156722116-156722138 GTGCCAAGGAAAAAGAAATTTGG - Intergenic
964543910 3:157811216-157811238 TTTCCAAGTTAAAATAAACTGGG - Intergenic
964666246 3:159177126-159177148 TTGGCCTGGAAAAAGAAACTTGG - Intronic
965116575 3:164497310-164497332 TTTCCAAAGAAAAAGAACCACGG + Intergenic
965469717 3:169075787-169075809 TGGCCTAGAAAGAAGAAACTTGG + Intergenic
966543535 3:181118662-181118684 TTTATCAGGAAAAAGAAAATCGG - Intergenic
966847326 3:184140759-184140781 TATCCTAGGAACAGGAACCTGGG + Intronic
967320951 3:188194556-188194578 TTTCCTAGGAAAAAGAAACTAGG - Intronic
967337040 3:188356200-188356222 TTTAGTAGGAAAAAGAAGTTGGG - Intronic
967734907 3:192941821-192941843 TCTCCTAAGAACCAGAAACTAGG + Intergenic
969364836 4:6688330-6688352 GTTCCTAGGAAACTGACACTCGG + Intergenic
969406237 4:6994165-6994187 ATTCCTAGGACAAAGAAACCAGG - Exonic
970103547 4:12554343-12554365 TTTCATAGGGAAAAAAAAGTTGG - Intergenic
970207635 4:13670954-13670976 TGTCCTTATAAAAAGAAACTTGG - Intergenic
970371301 4:15409443-15409465 TTTCTCAGGAAAGACAAACTGGG + Intronic
970625347 4:17871788-17871810 TATCCTAAGAACAAGAAACAGGG + Intronic
971226538 4:24758685-24758707 TTTCCTGGCAAAAAGAAAAAGGG - Intergenic
971953281 4:33382575-33382597 CTTCATAGGAAAAAGAAAAGCGG + Intergenic
972007337 4:34127473-34127495 GTTCCTAGGAAGCAGAGACTGGG + Intergenic
972129696 4:35816662-35816684 TTTCCTAGGTAAAAAAGAATGGG + Intergenic
972791712 4:42378580-42378602 CATCCTAAGAAAAAGAAAATTGG - Intergenic
973030327 4:45329878-45329900 TTTCTCAGGAAAAAGAATTTGGG - Intergenic
973991295 4:56410457-56410479 TTTCCTAGGAAACAAAACCTTGG + Intronic
974566630 4:63585729-63585751 TTTGATATAAAAAAGAAACTAGG - Intergenic
974644363 4:64672872-64672894 TTCCCCAGGAAAAAAAAACACGG - Intergenic
974981104 4:68958381-68958403 TATACAAGGCAAAAGAAACTAGG + Intergenic
975080121 4:70267659-70267681 TTTCCTAAGAAAATAAAAGTAGG + Intergenic
975252924 4:72200082-72200104 TTTCCTAGAAAAACAAAACCTGG + Intergenic
975434709 4:74337918-74337940 TGTCATAAGAAAAAGAAATTTGG - Intergenic
975439773 4:74398279-74398301 ATTCCTGGGCAATAGAAACTAGG + Intergenic
975921523 4:79396121-79396143 TTTCCTGGAAAAAAAAAAATGGG - Intergenic
976586062 4:86798542-86798564 ATGGCTAGGAAAGAGAAACTAGG - Intronic
977126309 4:93172950-93172972 TTTCCTAAGAGAAAGAAACTTGG - Intronic
977138711 4:93339647-93339669 TTTCCTGAGAGAAAGAAACAAGG - Intronic
977222174 4:94350830-94350852 TTTCCAAGCAAAAATGAACTGGG - Intergenic
977282297 4:95056321-95056343 TTTCCAAGTTAAAAGAAACATGG - Intronic
977761984 4:100749043-100749065 TTGCTTAGGAAAAAAAAACTTGG + Intronic
978890470 4:113820529-113820551 TTTTCTAGGAATTTGAAACTGGG + Intergenic
979073728 4:116243666-116243688 TATCCAAGGAAGAACAAACTTGG - Intergenic
979378712 4:119982148-119982170 TTTCCAAAGAAGAAGAAATTTGG + Intergenic
980836805 4:138204087-138204109 TTTGCTATGGAAAAGAAAGTTGG - Intronic
980985874 4:139693508-139693530 TAGCCAAGGAAAAAGAAACGTGG + Intronic
981486096 4:145288012-145288034 TTTCCTACAAAAAAGAAAACAGG + Intergenic
981707439 4:147675765-147675787 TTTCCTAGTTAAAAGAAAAAGGG - Intronic
981901492 4:149870339-149870361 TTTCCTAAGATCATGAAACTTGG - Intergenic
982266787 4:153545098-153545120 TTTCCTAGGCATAAGAAATCTGG + Intronic
982792123 4:159605285-159605307 TTTCATTGGCAAAAGCAACTAGG + Intergenic
983163442 4:164446475-164446497 TTCCCCAGGAGAAAGAAAATAGG + Intergenic
983399723 4:167247156-167247178 TTTCCTATTAAAAAGAAGATAGG + Intergenic
983556382 4:169062785-169062807 ATTCAGAGGAAAAAGAAAATAGG + Intergenic
984102605 4:175503212-175503234 TTTCCTAGGAAAAACAGCCTTGG + Intergenic
984297624 4:177873270-177873292 TTTCCCAAGAAAGAGAATCTGGG - Intronic
984542915 4:181062861-181062883 TACACAAGGAAAAAGAAACTAGG + Intergenic
984800002 4:183706022-183706044 TTTCCTAGGATACAAAAACATGG - Intronic
986097189 5:4570699-4570721 TTTCAGAGGAAAAAGAAAAGAGG - Intergenic
986349233 5:6861997-6862019 TCTCCTAAGAAAAATAAACCAGG + Intergenic
986764993 5:10917329-10917351 TTTCCTAGCAAGATGAGACTTGG - Intergenic
987308027 5:16656553-16656575 TTTTATAGCAAAAAGAAACTGGG + Intergenic
987539234 5:19232185-19232207 TTTCCCAGGAAGTAGAAACTTGG + Intergenic
987612132 5:20219338-20219360 TCTCCTAGCAAAAATAAGCTTGG + Intronic
988313915 5:29599082-29599104 GTTCATAAGAAAAAGAAATTTGG + Intergenic
989025316 5:37061208-37061230 TTTCCTAAGAAAAAATAATTAGG - Intronic
989485861 5:41991267-41991289 TTTGGTAGGAATAAGAAAGTTGG - Intergenic
989580552 5:43029051-43029073 TTTTCTAGTAAAAAGAAGCATGG + Intergenic
989731271 5:44652830-44652852 TTTCAAAGGTAAAAGAAAATAGG + Intergenic
989786027 5:45331329-45331351 CTTCCTAGGGAACAGACACTAGG + Intronic
989827477 5:45875368-45875390 ATTCCTAGAAAAAAAAACCTAGG - Intergenic
989963253 5:50440727-50440749 TTTCCTAGGAAGAAGGCAGTGGG - Intronic
990202051 5:53386604-53386626 TGTGCTAGGTAAAAGGAACTGGG - Intergenic
990379421 5:55207303-55207325 TTTACTAGGAAAAAGAAGAGGGG + Intergenic
990598215 5:57332013-57332035 TTCCATAGGAAAGACAAACTAGG - Intergenic
990674425 5:58167680-58167702 TTTCCCATGAAAAAGCTACTTGG + Intergenic
990980714 5:61600343-61600365 TTTCCTAGATGAAAGAAACAGGG - Intergenic
991899930 5:71450566-71450588 TTTCCTATTAAAAAAAAAGTGGG - Intergenic
993206395 5:84885958-84885980 TTTGCTGGGAAAAACAAACATGG + Intergenic
993488072 5:88511629-88511651 TTTTATAGAAAAAAGAATCTTGG + Intergenic
993678692 5:90848083-90848105 CTTCCTACTAAAAAAAAACTGGG - Intronic
993845885 5:92942702-92942724 TTTCCTAGGAAAACAAATGTTGG - Intergenic
994478238 5:100298402-100298424 TTACCTATGTAAAAGTAACTAGG - Intergenic
994885970 5:105562319-105562341 TTTCATAGGAAAAATAAATGAGG - Intergenic
995026103 5:107424514-107424536 TTCCCTAGAAAAAAGAAAGCTGG - Intronic
995092279 5:108192531-108192553 TTACCTAGGAAACATAAGCTTGG + Intronic
995541881 5:113193677-113193699 TTTCCTAGGAGAAACAGAATTGG - Intronic
995587020 5:113658745-113658767 TTTCTTTGCAAAAAGAAACTAGG + Intergenic
996094261 5:119381607-119381629 CATCCTAGGAAAAAGAGACAGGG - Intronic
996288037 5:121818167-121818189 TTGCATGGGATAAAGAAACTGGG + Intergenic
996894712 5:128466453-128466475 GTTTCTAGGAAAATCAAACTTGG + Intronic
997288522 5:132703393-132703415 TTTCCTAGGATATATAAAATAGG - Intronic
997713339 5:136024321-136024343 TTTCCCTGGAAAATGAAATTGGG + Intergenic
1000351954 5:160359138-160359160 TTTCCTCTGAAAAAAAAAATGGG - Intronic
1000358201 5:160421666-160421688 TTTTCTGGGAAGAAAAAACTAGG - Intronic
1000361674 5:160453412-160453434 TTTCCAAGGAAACCCAAACTTGG + Intergenic
1000835525 5:166149072-166149094 TTTCCTAGGGAAAAGAAAACAGG + Intergenic
1001016799 5:168149308-168149330 TTTAGTATGAAAAAGCAACTTGG + Intronic
1001388247 5:171357650-171357672 GTTCCTAGGGACAAGAAAGTGGG + Intergenic
1001427857 5:171635998-171636020 TTTCCTAGAAAAATGCAAATAGG + Intergenic
1001451941 5:171833262-171833284 TTTGTTAGGAACAAGACACTAGG - Intergenic
1001700145 5:173700943-173700965 TGTCCTAGGTAAAAGACACTAGG - Intergenic
1002819176 6:707935-707957 TTTCCCAAGAAAAAGAAATCAGG + Intergenic
1002839436 6:893372-893394 TTAACTAGGAAAAAATAACTTGG - Intergenic
1003302772 6:4899451-4899473 GTTCCTAGACAAAAGAAAGTGGG + Intronic
1004410878 6:15380351-15380373 TTTATTGGGAAAAAGAACCTTGG + Intronic
1006815678 6:36848337-36848359 GTTCAGTGGAAAAAGAAACTCGG - Intergenic
1007716065 6:43857016-43857038 CTTCCCAGGAAAAAGAGACCAGG - Intergenic
1007980327 6:46148554-46148576 TTTCCTAGGAAAAAAATTATTGG + Intergenic
1008334878 6:50290667-50290689 TGTCCTAGGAAAGATAAACTTGG - Intergenic
1008432129 6:51431174-51431196 CTTCCCAGAACAAAGAAACTAGG + Intergenic
1008956818 6:57224617-57224639 TTTCCCATTAAAAAGAAATTTGG - Intergenic
1009311926 6:62165456-62165478 TTTAATAAGAAATAGAAACTTGG + Intronic
1009909553 6:69908557-69908579 TTTTCTAGAAAAAATAAAATAGG - Intronic
1010263938 6:73846469-73846491 TCTCCCGGGAAAAAAAAACTGGG - Intergenic
1010366042 6:75052205-75052227 TTTTCTATGAAAAAGAGGCTTGG + Intergenic
1012095544 6:94954111-94954133 TGTCCTTCGAAAATGAAACTAGG + Intergenic
1012613362 6:101244679-101244701 TTTCCTGAAAAAAATAAACTAGG + Intergenic
1013825641 6:114207697-114207719 TTTCCAATGAAAAAAAATCTTGG + Intronic
1014486131 6:122001753-122001775 TTGCCCAGGATAAAGAAATTGGG + Intergenic
1014508340 6:122287899-122287921 TTTTCTAGGAAAAAGCATGTTGG - Intergenic
1015002592 6:128237148-128237170 TTTCCTTTGAAATAGAAAATTGG + Intronic
1015183952 6:130392041-130392063 TTCCCTGGGATAAAGAATCTTGG - Intronic
1015855708 6:137622304-137622326 GTTCCTTGAAAACAGAAACTTGG + Intergenic
1016042828 6:139449714-139449736 TTTCCAAGGAGAAAAAAACATGG - Intergenic
1016796107 6:148119261-148119283 TTTCCTAAGAAAAAGAGATGTGG + Intergenic
1018061017 6:160089788-160089810 TTTCCTAGGGAAAGGAAGCACGG - Intronic
1019667995 7:2261987-2262009 TTTCCCAAGAAATAGGAACTAGG + Intronic
1020598970 7:10248343-10248365 TTTCCTGGGACAGAGAACCTGGG + Intergenic
1021339089 7:19440802-19440824 TTTCCTGTGAAAAAGAAACTTGG - Intergenic
1021564329 7:22001838-22001860 TTTCAAAAGAAAAAGAAACTTGG - Intergenic
1021668147 7:23008066-23008088 TGTCCTAAGAAAAAGAAATAAGG + Intronic
1022091573 7:27111085-27111107 TTTCCAGGGAAGAAGAAACTTGG + Intronic
1022335991 7:29422735-29422757 AGTCCTATGAAAAAGAAACCTGG - Intronic
1023054781 7:36282850-36282872 TTTCCCATTAAAATGAAACTGGG - Intronic
1023500722 7:40846597-40846619 TTTCATTTGAAAAAGAAACAGGG - Intronic
1025815797 7:64910017-64910039 TTTGCCAGAAAAAAAAAACTAGG - Intronic
1026296521 7:69057588-69057610 TTTTCTAGGTACAAGAACCTGGG - Intergenic
1028388264 7:90284953-90284975 TGTTTTAGGAAGAAGAAACTGGG + Intronic
1028808348 7:95055008-95055030 TATTTTAGGAAAAAGAACCTTGG + Intronic
1030496199 7:110304019-110304041 TTAGCTAGGAAACAGAAGCTTGG - Intergenic
1030674616 7:112371414-112371436 TTTTCTAAGAAAAAGAAAATGGG - Intergenic
1030730158 7:112978293-112978315 TTTCCTAGTAAATAAAAAGTGGG + Intergenic
1030772809 7:113495838-113495860 TTTCCTAGTAAATAAAAAGTGGG + Intergenic
1030900658 7:115119298-115119320 TTTCCCAGGAAAGGGAAAGTGGG + Intergenic
1030917792 7:115338545-115338567 TTTCTTAGGAATAAGAATGTAGG - Intergenic
1030995094 7:116350584-116350606 CTTCCTAAGAGAGAGAAACTTGG + Intronic
1031789151 7:126078139-126078161 TTTGCTATGTAAAAGAAACCAGG - Intergenic
1031790976 7:126103963-126103985 TTTCCTAGCAGAAAAAGACTGGG + Intergenic
1032877197 7:136050249-136050271 TTTGCAATAAAAAAGAAACTTGG + Intergenic
1032976989 7:137236530-137236552 TTTGCTAAACAAAAGAAACTCGG - Intronic
1033534015 7:142295541-142295563 TTTCTTAGAAAAAAAATACTTGG + Intergenic
1033772630 7:144569507-144569529 TTTCTTAACAAAAAGAAAGTTGG - Intronic
1035190011 7:157158644-157158666 TTTCCTGGGGAAGACAAACTTGG + Intronic
1036530852 8:9585162-9585184 TTTCCTCTGAAAAAAAAATTAGG - Intronic
1037991306 8:23323096-23323118 TTTCCAAGGAAATAGAAACTTGG - Intronic
1038103205 8:24403329-24403351 ATACCTAGGAATAATAAACTGGG - Intronic
1039088461 8:33802902-33802924 TTCCCTAGGAAAGAAAAAATAGG - Intergenic
1039462503 8:37756862-37756884 TTTCCAAGGAAAAATCACCTTGG + Exonic
1039731474 8:40283356-40283378 TTTCTAAGGAAAAAAAAAATAGG + Intergenic
1040673640 8:49722607-49722629 GTTCCTAGCAAAAGGAAACATGG + Intergenic
1040758901 8:50813727-50813749 TTTCCTAAGTGAAAGAAGCTAGG + Intergenic
1041928812 8:63265828-63265850 TTTCCTAGGGAACAGACTCTGGG + Intergenic
1042294542 8:67205166-67205188 TTTCATAGTAGAAAGAAACAGGG + Intronic
1042294774 8:67206856-67206878 TTTCATAGTAGAAAGAAACAGGG - Intronic
1042587643 8:70359444-70359466 TGTGCTAAGAAAAAGAAACAAGG + Intronic
1042838856 8:73103375-73103397 ATCCCTAGGAAAAAAACACTTGG + Intronic
1043349794 8:79346250-79346272 TATCCTAGAAAAGAGAAACAGGG - Intergenic
1043521440 8:81050084-81050106 TTTCCTATAAAAACAAAACTAGG + Intronic
1043615539 8:82120457-82120479 TATTCTACAAAAAAGAAACTTGG + Intergenic
1043861461 8:85321945-85321967 TTTCCTGGGAATATGGAACTGGG + Intergenic
1044051259 8:87508017-87508039 TTTCATATCAAAAAGAACCTGGG + Intronic
1044077593 8:87842279-87842301 TCTCCTATGAAAAAGATGCTTGG + Intergenic
1044164332 8:88962610-88962632 GTTCAGAGGAGAAAGAAACTGGG + Intergenic
1044245065 8:89934367-89934389 CTTCCTAGGGAACAGAAATTGGG - Exonic
1044311883 8:90703017-90703039 TTTCATATGAAATAAAAACTTGG - Intronic
1044340016 8:91036201-91036223 TTTCTTAGGACTAAGAAACGGGG - Intronic
1045234162 8:100335444-100335466 TTTCCTTTGAAATAGAAACTAGG - Intronic
1045496113 8:102710290-102710312 TTTTCTAAGAAAAAGGAAGTAGG + Intergenic
1045635317 8:104179709-104179731 TTTCCTGGAAAAAAAAAACAAGG - Intronic
1046965876 8:120165227-120165249 TTTTCTAGGAAGAGGAGACTAGG - Intronic
1047333392 8:123913390-123913412 ATTCCTAAGAGAAAGAAAATAGG + Intronic
1047566728 8:126051972-126051994 TTTCCTATGAAATTGAATCTTGG - Intergenic
1047736387 8:127768887-127768909 TTTCCTATATAATAGAAACTGGG + Intergenic
1047984268 8:130216121-130216143 TCTCCTTGGAAAAACAATCTTGG + Intronic
1048493710 8:134918131-134918153 TTGCCTAGGAAAGACAAACTTGG + Intergenic
1048806061 8:138242389-138242411 TTTCCTAGGATAAAAGAACAAGG + Intronic
1049244875 8:141557073-141557095 CTTCATATGGAAAAGAAACTTGG - Intergenic
1050116131 9:2265337-2265359 TTTACTAGGAATAAAAAAATAGG - Intergenic
1050135738 9:2461806-2461828 TATCTTAGCAAATAGAAACTAGG + Intergenic
1050265874 9:3889091-3889113 CTTTCTAGGAAAAAAAATCTTGG + Intronic
1050267862 9:3909749-3909771 TTTCAGAGCAAAAAGGAACTAGG + Intronic
1051019277 9:12521507-12521529 TTATCTAGGAACAATAAACTAGG - Intergenic
1051174165 9:14346991-14347013 TCTCCTAGGGAGACGAAACTAGG + Intronic
1051652264 9:19340115-19340137 TTCCCCATGAAAAAGAACCTGGG - Intronic
1052058604 9:23932185-23932207 TCTCTTAGGAAAGAGAATCTGGG - Intergenic
1052408696 9:28095318-28095340 TTTCCTTGGAAAAACAACATTGG - Intronic
1052633254 9:31068158-31068180 TACCCTAGGAAAAAGAAAAAAGG + Intergenic
1053646689 9:40124546-40124568 TTTCTTAGGAAAAAAATATTTGG - Intergenic
1053759028 9:41339021-41339043 TTTCTTAGGAAAAAAATATTTGG + Intergenic
1054327696 9:63722431-63722453 TTTCTTAGGAAAAAAATATTTGG - Intergenic
1054537882 9:66251406-66251428 TTTCTTAGGAAAAAAATATTTGG + Intergenic
1055958553 9:81797333-81797355 TTTCCTAAGAAACAGAAAGATGG - Intergenic
1056017467 9:82405497-82405519 TTTCCCATAAAATAGAAACTTGG - Intergenic
1056171716 9:83991616-83991638 TTTCCTAGAAAAATGACACCAGG - Intronic
1056775038 9:89505647-89505669 TTTCCTAGCAACAAATAACTGGG - Intergenic
1056877091 9:90343929-90343951 TGTCCTAGGAAAATAGAACTTGG - Intergenic
1057031124 9:91775815-91775837 TCACCTGGGAAAAAGAAACCAGG + Exonic
1057326453 9:94069094-94069116 TTTCCTACTAAAAAGAACCAAGG - Intronic
1057810274 9:98252025-98252047 TTTCCCAGGAAAAAAAAAAGGGG + Intronic
1058543574 9:106037475-106037497 TCTCCTTGGATACAGAAACTGGG + Intergenic
1058997127 9:110309973-110309995 TTTATTAAGAAAAAGAAAGTGGG + Intronic
1059888267 9:118771040-118771062 TTTCATAAGAAAGAGAAACATGG - Intergenic
1187435359 X:19262984-19263006 ATTACTAGGAAAAAAATACTAGG + Intergenic
1187709383 X:22038719-22038741 TTTGCAAGGAAAAAGAAAACAGG - Intronic
1188349784 X:29114153-29114175 ATTCTTAGGAAACAGAAAATGGG - Intronic
1188633984 X:32405450-32405472 TATCTTAGAAAACAGAAACTAGG - Intronic
1188817392 X:34731867-34731889 TTTCCTAGGAGAAAGAAGGAGGG + Intergenic
1189724709 X:43956392-43956414 TTTCTTTGTAAAAAGAAGCTAGG + Intronic
1190788884 X:53681561-53681583 TTTGCTATGGAAAAGAAGCTGGG + Intronic
1192040679 X:67617902-67617924 CTTCATGGCAAAAAGAAACTAGG + Intronic
1192309905 X:70002290-70002312 TTGCCTTTGAAAAAAAAACTAGG - Intronic
1193060113 X:77197069-77197091 CTTCCTAGGACAAAGCACCTGGG - Intergenic
1193071956 X:77315364-77315386 TTTCCTAGTCAATAGACACTGGG - Intergenic
1193267660 X:79492347-79492369 TCTCCAAGTAAAAAAAAACTTGG + Intergenic
1194002292 X:88445423-88445445 TATCCTAGGAAATAGAAAAAAGG - Intergenic
1195765826 X:108295910-108295932 TTTAGTGGAAAAAAGAAACTTGG + Intronic
1195824852 X:108988590-108988612 TTTCCTAGACAAAAGAAAAGTGG - Intergenic
1195950220 X:110263332-110263354 TTTCACAGGTATAAGAAACTGGG - Intronic
1196720865 X:118852682-118852704 TTTGCTTGGAAACAGAAACAGGG + Intergenic
1197151926 X:123229562-123229584 AGACCTAGGGAAAAGAAACTGGG + Intronic
1197431272 X:126369175-126369197 TTTTAAAGGAAAAACAAACTTGG + Intergenic
1199119933 X:144039689-144039711 TTTCCTAGGAAACCAAACCTGGG - Intergenic
1202378795 Y:24259437-24259459 TTTCCTGGGAAAAGGAGGCTTGG + Intergenic
1202491987 Y:25410684-25410706 TTTCCTGGGAAAAGGAGGCTTGG - Intergenic