ID: 967320953

View in Genome Browser
Species Human (GRCh38)
Location 3:188194570-188194592
Sequence GTGGTCAACCTGATTTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967320953_967320958 6 Left 967320953 3:188194570-188194592 CCTAGGAAAATCAGGTTGACCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 967320958 3:188194599-188194621 TGTAGTTCTTGAGGGAAGAAGGG 0: 1
1: 0
2: 2
3: 24
4: 283
967320953_967320955 -3 Left 967320953 3:188194570-188194592 CCTAGGAAAATCAGGTTGACCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 967320955 3:188194590-188194612 CACAACTTCTGTAGTTCTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 111
967320953_967320959 23 Left 967320953 3:188194570-188194592 CCTAGGAAAATCAGGTTGACCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 967320959 3:188194616-188194638 GAAGGGAAGTATAATGATGTTGG 0: 1
1: 0
2: 1
3: 20
4: 245
967320953_967320957 5 Left 967320953 3:188194570-188194592 CCTAGGAAAATCAGGTTGACCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 268
967320953_967320956 -2 Left 967320953 3:188194570-188194592 CCTAGGAAAATCAGGTTGACCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 967320956 3:188194591-188194613 ACAACTTCTGTAGTTCTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967320953 Original CRISPR GTGGTCAACCTGATTTTCCT AGG (reversed) Intronic
903157912 1:21461217-21461239 ATGGACATACTGATTTTCCTGGG - Intronic
903452801 1:23466019-23466041 GCTGTCAACCTTGTTTTCCTTGG - Intronic
907959994 1:59270047-59270069 TAGGTCTACCTGATTTTCTTAGG + Intergenic
911060104 1:93740246-93740268 GTGGACATGCTGAGTTTCCTAGG - Intronic
913168089 1:116208035-116208057 GTGGTCCACATGAATGTCCTAGG + Intergenic
913502944 1:119488650-119488672 ATGGCCGACCTGACTTTCCTGGG + Intergenic
918124335 1:181569428-181569450 TTGGTCAAGTTGATTTTCTTTGG + Intronic
918314329 1:183310500-183310522 GGGGTCTTCCTGGTTTTCCTGGG - Intronic
920625043 1:207588670-207588692 GAGGTCCACATGATTTTCCTAGG - Exonic
921711427 1:218377484-218377506 GTGGTTAACCACATTTTACTGGG - Intronic
923302850 1:232658565-232658587 GTGGTCAAGATGATTTTCCCTGG - Intergenic
924301870 1:242647827-242647849 GTTATCATCCTGATTTTCTTGGG - Intergenic
1065168102 10:23001677-23001699 GAGGTCATCCTGATTTTACGTGG - Intronic
1070932310 10:80270142-80270164 GTGTTTAACATGATGTTCCTTGG - Intergenic
1072126868 10:92454367-92454389 GTGGCCAAGATGATTTTCTTAGG + Exonic
1074518163 10:114190956-114190978 GTGGTGACACTGAGTTTCCTGGG - Exonic
1075150110 10:119921172-119921194 GTGACCATCCTGGTTTTCCTGGG + Intronic
1076837649 10:133029146-133029168 CTGGTCAACCTGAGTCTCCTCGG - Intergenic
1081058790 11:38446693-38446715 GTGAGCAACCTGAATGTCCTTGG + Intergenic
1091978234 12:4843971-4843993 ATGGGCAAGCTGGTTTTCCTTGG - Intronic
1093816591 12:23556532-23556554 GTGGTAAAGCAGATTTTACTAGG - Intronic
1094351121 12:29526107-29526129 GTGGTCAAACTCATAATCCTGGG - Intronic
1095632044 12:44388799-44388821 GTGCTCAACATGCTTTTTCTAGG + Exonic
1099228928 12:80000821-80000843 TTGGGCATCCTGATTTTGCTAGG - Intergenic
1106234953 13:27853656-27853678 GTGGTGGACTTCATTTTCCTTGG - Intergenic
1106544744 13:30720705-30720727 GTGGTCAGGCTAATTTTGCTGGG + Intronic
1109067015 13:57708689-57708711 TTGTTCAACCTGTTTTACCTTGG + Intronic
1111816268 13:93157076-93157098 CTGGTAACCCTGCTTTTCCTGGG - Intergenic
1112705726 13:102067562-102067584 ATGGTCAATTTGATTTTCCTTGG - Intronic
1114201353 14:20523931-20523953 GTGGTCACTCTGATTTTCAAGGG - Intergenic
1114873014 14:26680655-26680677 TTGGTTAACCTGATCTTCCTAGG + Intergenic
1117525694 14:56600940-56600962 CTGTTTCACCTGATTTTCCTTGG - Intronic
1120358718 14:83466954-83466976 TTGATCAACCAGATTTTACTTGG + Intergenic
1121663170 14:95650997-95651019 GTGCCAAGCCTGATTTTCCTTGG - Intergenic
1122546796 14:102527595-102527617 GTTGCCAACCTGATGTTCCCAGG - Intergenic
1129518577 15:76171593-76171615 GTGGGCAGCCAGATTGTCCTTGG - Intronic
1129815521 15:78549545-78549567 TTGTTCAACCTGAGTTCCCTTGG + Exonic
1134456895 16:14401613-14401635 GTGGTCAACCAGCCTTTACTGGG + Intergenic
1134597704 16:15509171-15509193 ATGGGCAACCTGATTTCCATGGG - Intronic
1139280986 16:65770333-65770355 CTGGCTAACCTGATTTTTCTGGG - Intergenic
1141648071 16:85378027-85378049 GTGGTCAAGTGGATTTTTCTGGG + Intergenic
1142061636 16:88033806-88033828 GTGGTCAGCCTGATGCGCCTAGG + Intronic
1144592250 17:16534550-16534572 GAGGTTATCCTGTTTTTCCTGGG - Intergenic
1144620162 17:16813565-16813587 GAGGTCCCCCTGGTTTTCCTCGG - Intergenic
1144892524 17:18502137-18502159 GAGGTCCCCCTGGTTTTCCTCGG + Intergenic
1145139690 17:20442150-20442172 GAGGTCCCCCTGGTTTTCCTCGG - Intergenic
1145796174 17:27656528-27656550 GAGGTCCCCCTGGTTTTCCTCGG + Intergenic
1145810623 17:27761851-27761873 GAGGTCCCCCTGGTTTTCCTCGG + Intronic
1148957267 17:51364177-51364199 GTCGTCATCCTGATTTTTGTAGG + Intergenic
1151220355 17:72606926-72606948 CTGGAGAACCTGATTGTCCTGGG - Intergenic
1152196951 17:78924012-78924034 CTGGTCAGCATGGTTTTCCTGGG - Intronic
1153698355 18:7666789-7666811 GTTGTAAACCTTATTTTACTTGG + Intronic
1155223788 18:23710072-23710094 GTGGTCAAGCTTGTTCTCCTGGG + Intronic
1155649797 18:28127492-28127514 ATGGTCAAGCCAATTTTCCTAGG + Intronic
1156584664 18:38418891-38418913 GTGGTTAACGTGAATCTCCTTGG + Intergenic
1157432948 18:47644594-47644616 CTTGTGAACCTGATTTTCCCAGG - Intergenic
1158442090 18:57485048-57485070 GGGATCAACATGTTTTTCCTAGG - Exonic
1159002053 18:62983056-62983078 GTGATGAGCCTGATTTTCCATGG + Intergenic
1161217359 19:3101119-3101141 GTGGTCACCCTGATGTTTCAGGG + Intronic
1163740924 19:19011648-19011670 GTGGCCCACGTGAATTTCCTGGG + Intronic
1166200262 19:41232913-41232935 GTGGTTAACCAGATTGTCCAAGG + Intronic
926468342 2:13219647-13219669 GTGGCTAATCTGATTTTCCATGG + Intergenic
929099853 2:38301360-38301382 GTTGTCAATTTGATATTCCTTGG - Intronic
933617929 2:84503093-84503115 GTAGTAAAGGTGATTTTCCTTGG + Intergenic
938857350 2:135327232-135327254 GCTGTCACCCTGAATTTCCTTGG - Intronic
942770038 2:179505547-179505569 GTGGTTACCCAGTTTTTCCTTGG - Intronic
945837280 2:214848142-214848164 GTGATCACCCTGATTTTTGTAGG + Intergenic
945868596 2:215203188-215203210 TTGGGCAACCTGATTTTTCTTGG - Intergenic
945963065 2:216156257-216156279 TTGGTCATGCTGATTCTCCTTGG - Intronic
947469252 2:230385524-230385546 GTGTTTTATCTGATTTTCCTGGG + Intronic
948386890 2:237586078-237586100 GTGTTCAAGCTGGTTCTCCTGGG - Exonic
1169945064 20:10979243-10979265 GTGGTGAACCTCACTTTCCAGGG + Intergenic
1170415503 20:16134506-16134528 GTGGTCATCTTGATTTTGGTGGG + Intergenic
1170464062 20:16606912-16606934 ATGGTCACCCTGATTTCACTGGG + Intergenic
1175575633 20:60058524-60058546 CTGGGCAACCTGATCCTCCTGGG - Intronic
1179637467 21:42722556-42722578 GTGCCCAAGCTGATGTTCCTAGG + Intronic
1182176949 22:28300079-28300101 GTGGTGACACTGATTTTCCAAGG - Intronic
1182653445 22:31870757-31870779 GTGGCCAAACTCATGTTCCTGGG + Intronic
1185368137 22:50446323-50446345 GTGGTCAACCTGCATTCCCCTGG + Exonic
949118768 3:360313-360335 TTGGTAAAACTGATTTCCCTGGG - Exonic
949565496 3:5241156-5241178 GAGGTCAACATGACTTTCTTAGG + Intergenic
950904342 3:16524236-16524258 GTGTTTGACCTGATTTTCCCTGG - Intergenic
951642992 3:24856677-24856699 TTGCTCAACCTTATTTGCCTTGG + Intergenic
955988438 3:64599603-64599625 GTGGGCAACTGGACTTTCCTGGG + Intronic
956637433 3:71380252-71380274 CTGGCCAACCTGATGTTCTTGGG - Intronic
957206008 3:77199317-77199339 GTGTTCAACCAGGTTCTCCTTGG - Intronic
957501734 3:81066657-81066679 ATGGTAGACCTGACTTTCCTGGG - Intergenic
959480443 3:106865928-106865950 CTAGTCAAGCTGATTTTCATGGG - Intergenic
959989364 3:112613747-112613769 GTGGGCAACCTGAGTTTACTGGG + Intronic
963624960 3:147659680-147659702 GGGATCAAACTTATTTTCCTTGG - Intergenic
967320953 3:188194570-188194592 GTGGTCAACCTGATTTTCCTAGG - Intronic
971913816 4:32840667-32840689 GTTGTCAACCTGATTTGGCCGGG - Intergenic
973035369 4:45398968-45398990 TTTGTCAAACTGATATTCCTGGG - Intergenic
975060079 4:69986125-69986147 GTGTGCAACCTGATTCTTCTTGG - Intergenic
980289720 4:130829888-130829910 GTGGCTCACCTGATTTTTCTGGG + Intergenic
980483299 4:133418728-133418750 ATTGTCAACCTGCTTCTCCTAGG - Intergenic
980699398 4:136404186-136404208 ACTTTCAACCTGATTTTCCTAGG + Intergenic
981422264 4:144564824-144564846 GTGGGCAACCTCATCTCCCTTGG + Intergenic
982408985 4:155051876-155051898 GAAGTTAACGTGATTTTCCTGGG - Intergenic
983400658 4:167261639-167261661 ATGGTCAACCTGATTATCTTAGG + Intergenic
993303238 5:86240660-86240682 ATGGACAAACTGATTTTCCTTGG - Intergenic
994906956 5:105853073-105853095 GTTGATAACCTGATTTTCCATGG - Intergenic
997802271 5:136875995-136876017 GTGTTCAACCTGTATTTCATAGG - Intergenic
999353716 5:150904292-150904314 GTGGTCAGCCACATTTTACTGGG - Intronic
1001427197 5:171630420-171630442 GTGGTCCCCTTCATTTTCCTTGG - Intergenic
1002834430 6:853970-853992 TTGGTCATCCTCCTTTTCCTAGG + Intergenic
1003006723 6:2389480-2389502 GTGGGCACCCTGGTTTTTCTGGG + Intergenic
1007074516 6:39058002-39058024 GTGGTCCGCCTGCCTTTCCTGGG + Intronic
1007675143 6:43587544-43587566 TTGGTCATGCTGATTCTCCTTGG + Intronic
1008858975 6:56126120-56126142 GTGGACTTCCTGGTTTTCCTGGG - Exonic
1009277318 6:61699745-61699767 TTGGTCATCCTTATCTTCCTTGG + Intronic
1020741744 7:12028602-12028624 TTGGGCAGCCTGATGTTCCTTGG - Intergenic
1025109117 7:56198033-56198055 GTGATCTACCTGCTTTTTCTGGG - Intergenic
1027981402 7:85227871-85227893 GTGGTCAATCATATTTTCCATGG + Intergenic
1031504237 7:122561168-122561190 CTTGTCAACCTTATTTTCCATGG + Intronic
1033334881 7:140444091-140444113 GAGCTCAACCTGATTTGCCCTGG - Intergenic
1035990610 8:4485654-4485676 TTGGTCAGCCTCATTTACCTGGG - Intronic
1040757860 8:50802599-50802621 GTTGTCAGCCTGGCTTTCCTAGG + Intergenic
1053183143 9:35991670-35991692 GTGGCCAATGTGATCTTCCTGGG - Intergenic
1056334985 9:85559627-85559649 TTGGTCAACCTGGTTTTTCAGGG - Intronic
1060077304 9:120603537-120603559 GGGGTCAGCTTGAATTTCCTAGG + Exonic
1193476935 X:81977766-81977788 GTGGCCAACCTGGTTCTCCAAGG - Intergenic
1193671811 X:84396757-84396779 GTGCTCAACCTCAGTTCCCTGGG + Intronic
1194497315 X:94634082-94634104 TTGGTCAAACTGATTTTGCAAGG + Intergenic