ID: 967320957

View in Genome Browser
Species Human (GRCh38)
Location 3:188194598-188194620
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967320951_967320957 19 Left 967320951 3:188194556-188194578 CCTAGTTTCTTTTTCCTAGGAAA 0: 1
1: 0
2: 5
3: 43
4: 497
Right 967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 268
967320953_967320957 5 Left 967320953 3:188194570-188194592 CCTAGGAAAATCAGGTTGACCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
905913371 1:41669012-41669034 CTGGAGTTCCTGAGGGATCATGG - Intronic
906490720 1:46266472-46266494 ATGTAGTTCTTGGAGAAAGAGGG + Intronic
907182339 1:52581858-52581880 TTCAAGCTCTTGAGGGAAGATGG - Intergenic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
910763601 1:90759002-90759024 CTCTAGTTCTTGATGGCTGATGG - Intergenic
913440925 1:118896790-118896812 TCTTAGTTCTTAAGGGAAGAGGG + Intronic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
1063990578 10:11557712-11557734 CTCTAGTGCATGAGGAAAGAGGG + Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1069765008 10:70849677-70849699 CCGTGGTTGTTGAGTGAAGAGGG + Intronic
1070073818 10:73115788-73115810 GTTTAGTTCTTGGGGGAAGGGGG - Intronic
1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG + Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075886399 10:125903157-125903179 CTTTACTTCTTGATGGGAGAAGG + Intronic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1085165977 11:74399389-74399411 AGGAAGTTGTTGAGGGAAGATGG + Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG + Intronic
1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG + Exonic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1096432523 12:51558658-51558680 ATGTAGTTCTTGTGAGAAAATGG - Intergenic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1097882011 12:64694770-64694792 CTGTAGTTCTGGAAGGCTGAAGG - Exonic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1099520820 12:83659327-83659349 CTGTAGTACTTGTGGTAACATGG + Intergenic
1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG + Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106369025 13:29113349-29113371 CTCTAATTCTTGAGGCAAGTGGG - Intronic
1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107052409 13:36065599-36065621 CTATAGTTCTAGAGATAAGAGGG - Intronic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1109601463 13:64635336-64635358 TTGTAGTTTTTGATGGAAGTTGG - Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113575592 13:111393173-111393195 CTGTAGTTCATAAGGAGAGAGGG - Intergenic
1117133473 14:52708879-52708901 CTCTAATTCTTGAGGCAAGCAGG + Intronic
1117903754 14:60563225-60563247 CTGTGGTTCTTGACAGATGAAGG - Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1120108776 14:80527889-80527911 CTTCATTTCTTGGGGGAAGAAGG + Intronic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1125001158 15:34771231-34771253 CTGTAGTTATTTTAGGAAGATGG - Intergenic
1125419431 15:39489423-39489445 CTGTTGTCCATGATGGAAGAAGG + Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129527733 15:76232152-76232174 TTGTAATTATTGAGGGCAGAGGG - Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1140712519 16:77691573-77691595 CTGTAGTTCCTGAAGGACCATGG - Intergenic
1141071724 16:80962560-80962582 CTGTATATCTTAAAGGAAGATGG - Intergenic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1153371097 18:4316978-4317000 GTGTAGGTCATGAGGGAAGGAGG - Intronic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1165473247 19:36015255-36015277 CTGTAGGACTTGAGGGCACAGGG + Exonic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
925590404 2:5503482-5503504 ATGAAGTTCTTCAAGGAAGAAGG - Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
927278890 2:21286475-21286497 CTGTAGTTGTCCAAGGAAGATGG + Intergenic
929547754 2:42866730-42866752 CTGGTGTTCTTGAGCGATGATGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG + Intergenic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG + Intergenic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174682428 20:52421660-52421682 CTGTAGTCCTTGAGTCAAAAAGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1178496484 21:33090539-33090561 ATGCAGTGCCTGAGGGAAGAAGG - Intergenic
1178565155 21:33677233-33677255 CTGCAGTTCTTGGGAGAAGTAGG - Intronic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1180286406 22:10748670-10748692 CTTTACTTCTTGATGGGAGAAGG + Intergenic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
954728838 3:52639975-52639997 GTTTAGCTCTTGAGAGAAGAGGG + Intronic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG + Intronic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
965690297 3:171349153-171349175 CTGTTTTTCTTGAGAGATGAAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967562990 3:190939332-190939354 CTGCAGTTCTTGCCTGAAGAAGG + Intergenic
968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG + Intronic
972389882 4:38604587-38604609 CTAGAGTTCAGGAGGGAAGATGG - Intergenic
972779210 4:42271357-42271379 CTGTAGCTCCTGAGGGGAGGTGG - Intergenic
974722369 4:65757151-65757173 AAGTAGTTCTTGTGAGAAGAGGG + Intergenic
975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG + Intergenic
975903873 4:79186641-79186663 CTGTAATTCTAGTGGGAAGGAGG + Intergenic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
983445606 4:167846599-167846621 CTGTAGTTCATGAAGCAAGGAGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
986358296 5:6950240-6950262 CCGTACATCTTGAGGAAAGAAGG + Intergenic
986439469 5:7767047-7767069 CTGTAGTGGTTAAGAGAAGAAGG - Intronic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
990206188 5:53432109-53432131 ATGTATTTCTTAAGGGAAAATGG - Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
993509815 5:88757580-88757602 CTGTAGTTAATTAGGGAAGGGGG - Intronic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
994509403 5:100684692-100684714 TTGTGGTTCTTGTGGGAAAAAGG - Intergenic
994750348 5:103729752-103729774 ATGTAGTTCTTCAAGGAAGCAGG - Intergenic
996726140 5:126674756-126674778 TTTAAGTTCTTGAGAGAAGAAGG + Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG + Intronic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG + Intergenic
1010709021 6:79150941-79150963 TTGTAGTTATTCAGAGAAGAGGG + Intergenic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG + Intergenic
1012330816 6:97984067-97984089 CTGTATTTCATGAGGGATGTTGG - Intergenic
1013545061 6:111148643-111148665 CTGTAGTTCTTTACAGAAGTTGG + Intronic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1017725532 6:157274069-157274091 CTATAGTTATTGATGGAAGCTGG + Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1028979791 7:96954670-96954692 CTGCAGTTCTTGAGTGCATAGGG - Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036797801 8:11768764-11768786 CTTTAGTTCTCGAAGGAGGATGG - Intergenic
1038851724 8:31285158-31285180 CTGTACTTCTTGACATAAGAAGG - Intergenic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1040555026 8:48470700-48470722 CTGAAGTTCTTTACAGAAGAGGG + Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1041291305 8:56310857-56310879 CAGTAGTTCTTGTAGGAACATGG + Intronic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1043415890 8:80048582-80048604 GGGTAGTTCTTGAGGGAACGTGG + Intronic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047943771 8:129853154-129853176 CTGTAATTATTGAGGGTAAAAGG + Intronic
1048829946 8:138466129-138466151 CTGGAGCTCTTGTTGGAAGAGGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1051135407 9:13914606-13914628 ATGTGGTTCTTGAGGGACCAAGG - Intergenic
1051580402 9:18667121-18667143 CTGAATTCCTTGAGGGAAGGGGG - Intronic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059792377 9:117654075-117654097 CAGAAGTTCCTGAGGGAACACGG - Intergenic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061742786 9:132719354-132719376 CTGTAGTTTTTGAAGAAACAGGG - Intergenic
1203732765 Un_GL000216v2:105835-105857 CTTTACTTCTTGATGGGAGAAGG + Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1188648830 X:32604470-32604492 TTGTAGTTCTTGGGGGAGGGGGG - Intronic
1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG + Intronic
1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG + Intronic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1191923385 X:66281063-66281085 CTGAAGTTCTAGAGGCTAGAGGG + Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG + Intronic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic
1200031258 X:153297648-153297670 CTGTAGGTCTTGCAGGAAGCAGG - Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1201717015 Y:17056155-17056177 CTGTAGTTGTTGAGTGAACTTGG + Intergenic