ID: 967322979

View in Genome Browser
Species Human (GRCh38)
Location 3:188212516-188212538
Sequence CCAAATATGGAGAAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 264}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967322979_967322989 16 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322989 3:188212555-188212577 GGCTGATCTATTGGAAGAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 171
967322979_967322984 7 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322984 3:188212546-188212568 TACCCACCAGGCTGATCTATTGG 0: 1
1: 0
2: 0
3: 4
4: 53
967322979_967322988 15 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322988 3:188212554-188212576 AGGCTGATCTATTGGAAGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 135
967322979_967322991 28 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322991 3:188212567-188212589 GGAAGAGAGGGAGGTGACTCAGG 0: 1
1: 0
2: 0
3: 72
4: 582
967322979_967322990 19 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322990 3:188212558-188212580 TGATCTATTGGAAGAGAGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 176
967322979_967322992 29 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322992 3:188212568-188212590 GAAGAGAGGGAGGTGACTCAGGG 0: 1
1: 0
2: 5
3: 45
4: 434
967322979_967322983 -5 Left 967322979 3:188212516-188212538 CCAGCCTGCTTCTCCATATTTGG 0: 1
1: 0
2: 0
3: 20
4: 264
Right 967322983 3:188212534-188212556 TTTGGAAATGTTTACCCACCAGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967322979 Original CRISPR CCAAATATGGAGAAGCAGGC TGG (reversed) Intronic
900083450 1:875749-875771 CCAAATGGGGACAGGCAGGCAGG + Intergenic
900247042 1:1641210-1641232 CCAAGAATGGATATGCAGGCCGG + Intronic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
902718854 1:18291098-18291120 GCAGATGTGGGGAAGCAGGCGGG + Intronic
903281820 1:22254600-22254622 GCAGCCATGGAGAAGCAGGCAGG + Intergenic
905826632 1:41030537-41030559 CCAAATGTTGAGAAGGAGTCAGG - Intronic
906852956 1:49271714-49271736 CCAAAGATGGAGAAGAAGGAGGG - Intronic
907982533 1:59498222-59498244 ACAAATGAGGAGAAGTAGGCTGG + Intronic
908948602 1:69530489-69530511 TCCAATAAGGAGAAGCAGTCAGG - Intergenic
910303316 1:85732941-85732963 CCCAATCTAGAAAAGCAGGCTGG + Intronic
915613695 1:157017098-157017120 GCAAATATGGACAATCAGGATGG + Intronic
915837286 1:159187987-159188009 ACAAATAGAGAGAAGTAGGCAGG - Intronic
919718489 1:200806429-200806451 AAAAATGTGGAGAAACAGGCAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063036266 10:2289474-2289496 CCACATGTGGAGCTGCAGGCAGG - Intergenic
1063112936 10:3052653-3052675 CCTAATATGGGGGAGGAGGCGGG + Intergenic
1063828911 10:9930461-9930483 GCGAGTGTGGAGAAGCAGGCGGG + Intergenic
1065719774 10:28615556-28615578 CCAAGTCTGGTGAAGCAGGTAGG + Intronic
1068175288 10:53448952-53448974 GCAAATATAGATAAGCAAGCTGG - Intergenic
1071412259 10:85408268-85408290 CCAAAGCTGGAGGAGAAGGCTGG + Intergenic
1071415308 10:85435926-85435948 CCAAAGAGGGAGATGCAGGCTGG - Intergenic
1072253932 10:93602506-93602528 AAAAAGATGGAGAAGCAGGGGGG - Intronic
1073834836 10:107429383-107429405 CCAAGTAAGGAGCAGCAGGCAGG - Intergenic
1074594847 10:114852807-114852829 AGAAATATAGAAAAGCAGGCTGG - Intronic
1075733666 10:124651318-124651340 CCAAAGGTGCAGAAGGAGGCTGG + Intronic
1079666211 11:23109196-23109218 CCAAAGATAGAGAAGGAGGTTGG + Intergenic
1079953028 11:26827740-26827762 GCAAATATAGCCAAGCAGGCAGG - Intergenic
1084595456 11:70114178-70114200 TTAAAGATGGAGAAACAGGCTGG + Intronic
1085972842 11:81613640-81613662 TCAAAAATGGAGAAACAGGCTGG + Intergenic
1086782449 11:90924146-90924168 CCATATATTGACAAGCATGCAGG + Intergenic
1090666102 11:128916067-128916089 CCAGATATGGAAAAAAAGGCAGG - Intronic
1090666120 11:128916163-128916185 CCAGATATGGAAAAAAAGGCAGG - Intronic
1090893655 11:130950178-130950200 TCAAATATGGAGAATGGGGCAGG - Intergenic
1091611831 12:2016970-2016992 CCAACTCTGGAAAAACAGGCTGG + Intronic
1095038981 12:37421901-37421923 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1095049058 12:37541281-37541303 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1096080335 12:48828460-48828482 CCAAGACTGGAGCAGCAGGCTGG + Exonic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101150852 12:101881080-101881102 CCACACATAGAGAAGAAGGCTGG + Intronic
1104579153 12:129997054-129997076 CCCAAATTGGACAAGCAGGCTGG - Intergenic
1104610990 12:130227780-130227802 CCAAAAAGAGAGAAGCAGGTTGG + Intergenic
1104684070 12:130772843-130772865 CCAGTCATGGAGAGGCAGGCAGG + Intergenic
1104852881 12:131886452-131886474 CAAAATATGGCTAACCAGGCCGG + Intergenic
1107271562 13:38624800-38624822 CCAAACATAGATAAGCAAGCTGG + Intergenic
1107642661 13:42459893-42459915 CCAAAAATGAAGAAAGAGGCAGG + Intergenic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108152959 13:47555583-47555605 ACAAATTTGGAGAAGCAGCATGG - Intergenic
1108393901 13:49974438-49974460 TTAAAGATGGAGAAACAGGCCGG - Intergenic
1110553648 13:76834419-76834441 CCAAATATGGTGAAGTTGGCAGG - Intergenic
1111012648 13:82331196-82331218 GCAAATATAGATAAGCACGCTGG + Intergenic
1113144886 13:107197542-107197564 CCACACATGAAGAAGCAGGCAGG - Intronic
1113474264 13:110569069-110569091 GCAGACATGGACAAGCAGGCTGG + Intergenic
1116855846 14:49951646-49951668 CCAAAGCTGGAGAAGCAGCAAGG + Intergenic
1118038409 14:61892545-61892567 ACAAGTCTGGAGCAGCAGGCAGG - Intergenic
1119006403 14:70934320-70934342 CCAAATGTTGAGAAACAAGCTGG - Intronic
1119484175 14:74977592-74977614 CCAATTCTGGAGCAGCAGGGAGG - Intergenic
1120125343 14:80735504-80735526 CCAAAGAGGGTCAAGCAGGCTGG + Intronic
1120634305 14:86931998-86932020 CTAAAAATGAAGATGCAGGCCGG - Intergenic
1121050992 14:90818812-90818834 GCAAATCTGGAGAGGCAGACTGG - Intergenic
1121458793 14:94057164-94057186 CCAACTATGAAGCAGCAGACTGG + Intronic
1123801531 15:23826149-23826171 CAAAATATGGAGAGACAGGCAGG - Intergenic
1124199512 15:27666278-27666300 CCAAATTTTGAAAGGCAGGCTGG - Intergenic
1126360336 15:47839129-47839151 CCAAATCTGGAGAACCATGTGGG + Intergenic
1126729026 15:51662592-51662614 CCAAAAATGGGGAAGAAGGGTGG - Intergenic
1126814521 15:52441688-52441710 CCAAATGAGGAGAAGAAGTCAGG - Intronic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1127913470 15:63437129-63437151 CCAAACCTGGTGAATCAGGCTGG - Intergenic
1129695540 15:77738892-77738914 TCCCATATGAAGAAGCAGGCAGG + Intronic
1129996800 15:80013787-80013809 TAAAAAATGGGGAAGCAGGCTGG - Intergenic
1130149140 15:81298154-81298176 TCAAAAATGCAGAAACAGGCTGG + Intronic
1130309658 15:82742117-82742139 CCAAAATTGGAGAGGCAGACAGG + Intergenic
1132471906 16:109261-109283 TTAAATGTGGACAAGCAGGCCGG - Intronic
1133605190 16:7379966-7379988 CTAACTTTGGAGAAGGAGGCAGG - Intronic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1135229639 16:20693715-20693737 CAATAAGTGGAGAAGCAGGCAGG - Intronic
1138305177 16:55967831-55967853 ACAAAAATGGTGTAGCAGGCAGG - Intergenic
1138710491 16:58965407-58965429 CCCTATATGGGGAAGAAGGCAGG - Intergenic
1139108916 16:63864641-63864663 ACAAAAAAGGAGATGCAGGCCGG + Intergenic
1139263646 16:65619969-65619991 CAAAATATGTAAAGGCAGGCAGG - Intergenic
1139972020 16:70782163-70782185 CCAAAGGTGGAGACACAGGCTGG + Intronic
1140237951 16:73175421-73175443 ACCAAGTTGGAGAAGCAGGCAGG - Intergenic
1141281734 16:82635312-82635334 CCAAATCTGGAGGAGCAGTAGGG + Intronic
1142225606 16:88875885-88875907 ACACATATGGAGACGCAGGCCGG + Exonic
1143121539 17:4610741-4610763 CCAAATAAGGAAAAGCACTCCGG + Intergenic
1143673458 17:8412892-8412914 CCAAATACGGGGATGAAGGCAGG + Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145778076 17:27543361-27543383 CCAGCTATGGAGAGGCAGGTTGG + Intronic
1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG + Intergenic
1147976981 17:44253426-44253448 CCAAGTATGGAGAAGGAAGGAGG - Intronic
1148317553 17:46716551-46716573 CTAAAAATGGAGGTGCAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149327872 17:55550772-55550794 GCAAATATAGATAAGCAAGCTGG - Intergenic
1150197285 17:63313379-63313401 CCAGATATGGACCATCAGGCAGG + Intronic
1151582494 17:74988172-74988194 CCAACAATGGAGAAGCGGACAGG - Intronic
1151887060 17:76929214-76929236 CCAAAGATGATGAAGCAGGGAGG + Intronic
1152397592 17:80043813-80043835 ACAAATATGGAAGAGGAGGCCGG - Intronic
1152602454 17:81271329-81271351 CCACTCATGGAGCAGCAGGCAGG - Intronic
1154006409 18:10531925-10531947 CAACATATGGAAAAGCAGGGAGG + Intronic
1154121364 18:11655082-11655104 CCCAGTTTGGAGAAGGAGGCCGG + Intergenic
1157028527 18:43876496-43876518 CCAACTCTGGAGAAGCTGCCAGG + Intergenic
1157052889 18:44189384-44189406 CCAAATATGAACAAGAAAGCTGG - Intergenic
1157469486 18:47977902-47977924 TAAAATATGGAAAAGCAGGCCGG - Intergenic
1163522084 19:17797456-17797478 CCATAGATGGGGAAACAGGCTGG - Intronic
1164245269 19:23422653-23422675 CCTAACGTGGAGAAGGAGGCAGG + Intergenic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164951718 19:32343059-32343081 CCAAAAAGGGAGAGGCAGGGAGG + Intergenic
1166331305 19:42079493-42079515 ACAACAGTGGAGAAGCAGGCGGG + Exonic
1167683972 19:50943868-50943890 CCATAGATGGAGAAGCAGATGGG + Intronic
925329197 2:3045061-3045083 CCAACTGTGGACAACCAGGCAGG - Intergenic
925809058 2:7680460-7680482 TCAGATAATGAGAAGCAGGCCGG - Intergenic
926149150 2:10415155-10415177 CCAAGTCTGCAGAACCAGGCAGG - Intronic
926157688 2:10466598-10466620 CCAAAACTAGAGAAACAGGCGGG + Intergenic
927775228 2:25897587-25897609 AAAAATATCCAGAAGCAGGCAGG - Intergenic
928458585 2:31448711-31448733 CTAAACATGGAGGTGCAGGCAGG - Intergenic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
928893981 2:36240043-36240065 CCATATAAGGAGAACCAGGTAGG - Intergenic
929487144 2:42364931-42364953 GCACATAAGGAAAAGCAGGCAGG - Intronic
932309729 2:70729872-70729894 TTAAATATGGAAATGCAGGCTGG - Intronic
932455985 2:71850397-71850419 ACAAATATGGAGCAACAAGCCGG - Intergenic
933263005 2:80151030-80151052 GCAAAAATGAAGAAGTAGGCAGG + Intronic
935519124 2:104082239-104082261 CCAAAATTGGAGAGACAGGCAGG - Intergenic
935872556 2:107467142-107467164 CCAAATATGCATAAGCAGAGAGG - Intergenic
935903432 2:107817300-107817322 CCAAAACTGGAGAAGCAGTGGGG - Intergenic
936108344 2:109644816-109644838 GCAAATATTGACAAGCAGCCGGG - Intergenic
936800795 2:116262485-116262507 TCAAACATGAAGAAGGAGGCAGG + Intergenic
936949340 2:117962345-117962367 CCAATTAAGGACAAGTAGGCTGG + Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
938011127 2:127829847-127829869 ACAAAAATGGAGAACAAGGCTGG - Intergenic
944538228 2:200732148-200732170 CCATATATGGGGAAACAGTCTGG - Intergenic
946028793 2:216689232-216689254 CCTGATGTGGAGAGGCAGGCAGG - Intronic
947072161 2:226301171-226301193 CGAAATATGGAGAAGCAATTGGG + Intergenic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
1169268243 20:4180712-4180734 TCAAAGATGGAGAAGCAGTCAGG - Intronic
1169811491 20:9613296-9613318 CCAAATTTGGAGAGGCAGACAGG + Intronic
1170063845 20:12289158-12289180 TAAATTATTGAGAAGCAGGCTGG - Intergenic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1171532882 20:25863665-25863687 CCACATCTGGTGAGGCAGGCAGG + Intronic
1171533314 20:25866166-25866188 CCACATCTGGTGAGGCAGGCAGG + Intronic
1171543594 20:25984784-25984806 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1171807040 20:29689453-29689475 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1174769044 20:53281252-53281274 CTAAATAATGAGAAGCAGCCAGG + Intronic
1174873824 20:54207437-54207459 CCAAAAACGGGGAAGGAGGCAGG + Intergenic
1175409610 20:58758061-58758083 CCATATGTGGAGAACCAAGCTGG - Intergenic
1176659976 21:9624920-9624942 CACAATTTCGAGAAGCAGGCAGG - Intergenic
1176685115 21:9839786-9839808 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1176942819 21:14944471-14944493 CCAGAGATGGAGAAGGAGACTGG + Intergenic
1179068949 21:38053818-38053840 CCACAGATGGAGAAGTAGGTGGG + Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1181263295 22:21614153-21614175 CAACATATGAAGAATCAGGCAGG - Intronic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1181899790 22:26144078-26144100 CCACATATGCAGCAGCAGACTGG - Intergenic
1184667652 22:45997164-45997186 GCAAGGATGGAGAGGCAGGCAGG + Intergenic
949177152 3:1078464-1078486 CAAAATATTGAGAATCAGGCTGG + Intergenic
949607480 3:5670192-5670214 CAAAATTTGGTGAAGTAGGCTGG + Intergenic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
950194107 3:10997000-10997022 CCAAATATGTTGTAACAGGCTGG - Intronic
951542803 3:23798319-23798341 TCAAGCATGGAGCAGCAGGCAGG - Intergenic
951974427 3:28488278-28488300 CCAAATTTGGAGAAAAAGACAGG - Intronic
952412011 3:33057797-33057819 CCCAAGATGAAGAAGCAGGTAGG - Intronic
952959056 3:38578406-38578428 CTATATAAGGAGAAACAGGCTGG - Intronic
953514071 3:43572582-43572604 CCAGATACACAGAAGCAGGCTGG + Intronic
954474945 3:50735631-50735653 CCTAATCTAGAGAAACAGGCTGG - Intronic
955792617 3:62604278-62604300 CCAAAATTGGAGAGACAGGCAGG - Intronic
955916277 3:63911944-63911966 CCACCTATGGAGGAGCCGGCCGG - Intronic
958037730 3:88190024-88190046 GCAAACATGGAGAAGCAAACTGG + Intergenic
958095545 3:88939422-88939444 GCAAATATAGACAAGCAAGCTGG - Intergenic
958106852 3:89085455-89085477 ACAAATATGGAGGAGCAGATTGG + Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959861135 3:111216141-111216163 CCACCTATGGACTAGCAGGCTGG + Intronic
960723263 3:120645308-120645330 CCAAATATGCAGAGGAAGGTGGG - Intronic
961368810 3:126417517-126417539 CCACAGTTGGAGAGGCAGGCAGG + Intronic
963017972 3:140843775-140843797 CCATATTTGCTGAAGCAGGCAGG + Intergenic
963308545 3:143681833-143681855 CCAGTGATGGAGAAGCAGGTGGG + Intronic
964124761 3:153224431-153224453 CGAAATATTGAGAAGAAGGGAGG + Intergenic
967291905 3:187929570-187929592 CCACATGTACAGAAGCAGGCTGG + Intergenic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
969289925 4:6232120-6232142 CCAAATAAGGAGAAGGCCGCAGG - Intergenic
971714692 4:30160368-30160390 ACAAACTTGGACAAGCAGGCTGG + Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
972975964 4:44636561-44636583 CCAAATATGTGGAAGCAGCCAGG + Intronic
974510214 4:62830404-62830426 CCTAAGATGGAGAATAAGGCTGG - Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
982536039 4:156607342-156607364 CCAAATATGGACAGGAATGCTGG - Intergenic
984727778 4:183037827-183037849 TCAAATATGGAGAAGCATTTGGG + Intergenic
985198774 4:187462313-187462335 TAAAATTTGGAGAAGCAGCCAGG + Intergenic
985317431 4:188672904-188672926 AGAAATCTGGAGAAGCAGTCTGG - Intergenic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987309556 5:16669101-16669123 CCAAACCTGGACAAGCAGGAGGG + Intronic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
990371982 5:55129360-55129382 CAAAATTTGGAGAAGCAAACTGG + Intronic
992116279 5:73541138-73541160 GGAAATCTTGAGAAGCAGGCAGG + Intergenic
998879743 5:146633842-146633864 CTAAGGATGGAGAAGCAGACGGG - Intronic
1001658298 5:173371091-173371113 TCACAAATGCAGAAGCAGGCTGG - Intergenic
1002163349 5:177330214-177330236 CCAGAACTGGAGAAGAAGGCAGG + Intergenic
1004609638 6:17227528-17227550 ACAAATATAAAGCAGCAGGCAGG + Intergenic
1005559969 6:27029791-27029813 TTAAATATGGAAAAGCTGGCTGG - Intergenic
1006382261 6:33706409-33706431 CCAGCTGTGGAGAAGCTGGCAGG + Intronic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1006628697 6:35415861-35415883 CCAAATTTTGAAAGGCAGGCAGG + Intronic
1007694907 6:43725763-43725785 CCAAATTGGGAGAAGCAGAACGG + Intergenic
1008541950 6:52553177-52553199 TCAAATGTGGAGAGGCAGGGAGG - Intronic
1008695266 6:54028704-54028726 GCAAAGATGGACCAGCAGGCAGG - Intronic
1011121445 6:83958081-83958103 CCAAATATGGAGAATATGTCTGG - Intronic
1011746094 6:90409204-90409226 CCAAACATGTGGAAGCAGGTGGG - Intergenic
1013305122 6:108840576-108840598 CCAAGAATGTAGAAGTAGGCAGG - Intergenic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1017659422 6:156659223-156659245 CCAAAATTAGAGAGGCAGGCAGG + Intergenic
1018425707 6:163678789-163678811 CCTAATATGGAAAAGTATGCAGG + Intergenic
1019823309 7:3262557-3262579 CCACACATGGGGAAGCAGACAGG - Intergenic
1020580422 7:9992193-9992215 CCAGATTTAGAGAAGGAGGCAGG + Intergenic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023241853 7:38157308-38157330 ACAAATTTGGAGAAGGAAGCTGG + Intergenic
1024050751 7:45621661-45621683 CCAAAGATGGGCCAGCAGGCAGG - Intronic
1025284601 7:57651550-57651572 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1025294969 7:57769855-57769877 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1025301366 7:57821688-57821710 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1026479981 7:70769795-70769817 CCAAAGATGGAGAATAAGCCTGG + Intronic
1027045043 7:74985560-74985582 CCAAAGATTGAGAAACAGCCTGG + Intronic
1027766658 7:82352578-82352600 TAAAAGATGGAGATGCAGGCTGG + Intronic
1029788407 7:102816762-102816784 CCAAATGTGGGGAGGCAGGGAGG - Intronic
1030064834 7:105651677-105651699 CTAGAGATGGAGAAGCAGGTGGG - Intronic
1033667958 7:143461245-143461267 ACAAATATAGACAAGCAAGCTGG - Intergenic
1034821214 7:154217916-154217938 CCAGATCTGGAGCAGCTGGCGGG + Intronic
1040307842 8:46221438-46221460 GCAAAAATGGAAAAGCAGGGTGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1043102237 8:76060683-76060705 CCACACTTGGAGAAGCCGGCCGG - Intergenic
1043264079 8:78240496-78240518 CCAGATATGGAAAAGAAGGCTGG + Intergenic
1043377503 8:79667183-79667205 TCAAAGATGAAGAAGCAGGCCGG + Intergenic
1044260172 8:90110143-90110165 CCAAAACTGGAGAAACAGACAGG - Intergenic
1047322589 8:123801993-123802015 ACAAGTCTGGAGAAGTAGGCTGG + Intronic
1048222334 8:132553278-132553300 CAAAATATAGAAAAACAGGCTGG + Intergenic
1049006565 8:139859311-139859333 CCAAAAATGGAAGCGCAGGCTGG - Intronic
1049226583 8:141454570-141454592 ACAAATATGGGGAAGCAGAAGGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050195943 9:3084902-3084924 CCAGATCTGGAGAAGAGGGCAGG + Intergenic
1050353456 9:4761756-4761778 CTAAAGATGGAGAAGCAGACTGG - Intergenic
1051383287 9:16480592-16480614 CCACACTTGGAGCAGCAGGCCGG + Intronic
1051439842 9:17072689-17072711 CCACACTTGGAGCAGCAGGCTGG + Intergenic
1051457125 9:17271323-17271345 CCAAAAATGGAAACCCAGGCTGG + Intronic
1052051638 9:23855172-23855194 CCACATAGGAAGAAGCAGGTAGG - Intergenic
1052324436 9:27202264-27202286 CAATTTATGGAGCAGCAGGCAGG - Intronic
1053784309 9:41643621-41643643 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1053784926 9:41646726-41646748 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054172266 9:61853754-61853776 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054172749 9:61856223-61856245 CCACATCTGGAGAGGCCGGCAGG - Intergenic
1054173651 9:61860671-61860693 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054447123 9:65382781-65382803 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054447597 9:65385226-65385248 CCACATCTGGAGAGGCCGGCAGG - Intergenic
1054448506 9:65389736-65389758 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054663889 9:67720110-67720132 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054664791 9:67724578-67724600 CCACATCTGGAGAGGCCGGCAGG + Intergenic
1054665271 9:67727051-67727073 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1055237117 9:74136040-74136062 CTAAATATGGAAAAGAAGACAGG - Intergenic
1055256713 9:74380256-74380278 CCAAATATCGAGGACCAGGGAGG + Intergenic
1055458706 9:76496074-76496096 ACTAATATGGATAAGCAAGCTGG + Intronic
1055486757 9:76763743-76763765 CCCAATATGGAGAAGGAGAGGGG + Intronic
1056519656 9:87388567-87388589 ACAAAAATGGAACAGCAGGCTGG + Intergenic
1058335945 9:103829063-103829085 TTAAAAATGGAGAAGCAGCCAGG - Intergenic
1058445706 9:105053080-105053102 TTAAATATGGTGAAGCAGGTCGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1058950443 9:109898747-109898769 CCAAATATGGGGGAGGAGGAAGG - Intronic
1060056807 9:120421146-120421168 TCAAAGCTGGAGAGGCAGGCTGG - Intronic
1061709016 9:132474699-132474721 CCAAAGGTTGAGAAGAAGGCAGG + Intronic
1203637539 Un_KI270750v1:126764-126786 CACAATTTCGAGAAGCAGGCAGG - Intergenic
1186676607 X:11823973-11823995 CCAAATATGGGGAAGCTGATGGG + Intergenic
1187115579 X:16346906-16346928 CCAAAACTGGAGAAACAGACTGG - Intergenic
1187241234 X:17515075-17515097 ACAAATTTGGAGAAGCAGAATGG + Intronic
1188681329 X:33011062-33011084 CCTAAAATGGAAAAGCAAGCAGG - Intronic
1188768726 X:34127591-34127613 CCAAATGTGGAAAAGTAGGTGGG + Intergenic
1190064580 X:47231177-47231199 CCAGAGATGGAAAAGCAAGCAGG + Intergenic
1193955999 X:87863523-87863545 CCAAATATGAAGAACGAGGCCGG - Intergenic
1193956490 X:87870414-87870436 TCAAATATGCAGAAACAGGAGGG + Intergenic
1195781125 X:108465698-108465720 CCAAATATCTAGAAGAAAGCAGG - Intronic
1196116727 X:112006823-112006845 CCAGATGGGGAGAAACAGGCAGG + Intronic
1196731715 X:118947576-118947598 TAAATTATGGAGAATCAGGCTGG + Intergenic
1197201234 X:123750615-123750637 CCAAAAATGCTGTAGCAGGCTGG + Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1199686783 X:150272187-150272209 CCAGACATGGAGAAGCAGAATGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201481156 Y:14440949-14440971 TTAAATATGGGGAAGCGGGCAGG - Intergenic