ID: 967327606

View in Genome Browser
Species Human (GRCh38)
Location 3:188257795-188257817
Sequence CACTTTGCAAATAAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 465}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967327601_967327606 24 Left 967327601 3:188257748-188257770 CCTAATCTTAGAAGAAAAACAAC 0: 1
1: 0
2: 5
3: 75
4: 766
Right 967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG 0: 1
1: 0
2: 3
3: 52
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967327606 Original CRISPR CACTTTGCAAATAAGGAACT GGG Intronic
900582911 1:3418147-3418169 TGCTTTGCAAATAAGTGACTTGG + Intronic
901174750 1:7290892-7290914 CATTTTGCAAATGAGGAAATGGG + Intronic
901184001 1:7360499-7360521 TATTTTGCAAACAGGGAACTGGG - Intronic
901269538 1:7941344-7941366 CACTATGCAAATGAGGAAAGTGG + Intronic
901690884 1:10972657-10972679 CATTTTGCAGAAAAGGAAATGGG - Intronic
902895504 1:19477026-19477048 CATTTTGCAGATAAGGAAACCGG - Intronic
902938617 1:19783230-19783252 CAGTTTGCAAATTAGGAAACAGG + Intronic
902961083 1:19963188-19963210 CAGTTTTCACATAAGAAACTGGG - Intergenic
902996135 1:20226705-20226727 CATTTTACAGATAAGGAAATAGG - Intergenic
903345365 1:22680921-22680943 CTCTTTGTAAATAAGGAAGCAGG - Intergenic
904137381 1:28324039-28324061 CACTTAGCAAATGAGGAAATAGG - Intergenic
904172557 1:28601669-28601691 CACACTGCAAATCAAGAACTGGG + Intronic
904495956 1:30886801-30886823 CAATGTGCATATAAGGAACCTGG - Intronic
904819697 1:33233846-33233868 CACTTCCTAAATATGGAACTGGG + Intergenic
904868286 1:33600024-33600046 CACTTTACAAATGAAGAAATAGG - Intronic
905791951 1:40794423-40794445 CATTTTGCAGACAAGAAACTGGG + Intronic
906606764 1:47178131-47178153 GACTTTGTAAATAAATAACTGGG - Intergenic
906791133 1:48659614-48659636 CACTTTGCAAGCCAGGAGCTTGG - Intronic
907381669 1:54095791-54095813 CATTTTACAGATAAGGAAATAGG - Intronic
907550752 1:55302737-55302759 CATTTTACAGATGAGGAACTGGG - Intergenic
907623528 1:56006630-56006652 AACTGTGGATATAAGGAACTAGG + Intergenic
907885118 1:58585678-58585700 CACTTTACAAATAAGGAAACAGG + Intergenic
907913788 1:58850241-58850263 CATTTTGGAAATAAGTAAATGGG + Intergenic
907959847 1:59268649-59268671 CACTTTACAGATAAGGAAACTGG - Intergenic
908064803 1:60391264-60391286 TACTTTTCATATAGGGAACTTGG - Intergenic
908770343 1:67590350-67590372 CAATTTGAAAAAAAGGCACTTGG + Intergenic
909071577 1:71000295-71000317 CACTTTCCAGATAAGGAAACTGG - Intronic
909181770 1:72433328-72433350 CACTTTGCAAACAAACAACATGG + Intergenic
909323274 1:74317432-74317454 CACTTTAGAAATAAGAAGCTGGG + Intronic
909381433 1:75003462-75003484 CACTTTGCTAATAAGAAAACTGG + Intergenic
909499287 1:76315740-76315762 TATTTTGCAAATAAGGAAATTGG - Intronic
909744076 1:79071159-79071181 CACTGTGCAGATTAGGAAATTGG + Intergenic
911121777 1:94303444-94303466 CATCTTGCAAATCTGGAACTCGG - Intergenic
911199972 1:95034566-95034588 CACTTTGCAGATGAGGAATCTGG + Intronic
911453095 1:98090848-98090870 CACTTTACAGATAAGGAAACAGG + Intergenic
911633926 1:100213127-100213149 CACTTTCCATTTAAGGAAATTGG - Intronic
912630273 1:111241017-111241039 CATTTTGCAAATGAAGAAATTGG + Intronic
913046924 1:115081641-115081663 CACTTTGCAGATGAGGAAGCTGG - Intronic
913233826 1:116763665-116763687 CACTTTACAAAGAAGGAAACAGG + Intronic
913327323 1:117638273-117638295 CATTTTGCAGATAAGGAAACTGG - Intergenic
915224448 1:154402268-154402290 CACTTTTTAGATAAGGAGCTAGG - Intergenic
915320761 1:155055069-155055091 CATTTTACAAATTAGGAAATTGG - Intronic
916487694 1:165274038-165274060 CACTTTACAGATTAGGAAATTGG + Intronic
919844665 1:201634322-201634344 CACTTTGCAGATGAGGAAACTGG + Intronic
920462209 1:206149833-206149855 CACCTTCCAAGTATGGAACTTGG - Intergenic
921749872 1:218780016-218780038 CAATGTGCAAATAAGGAAACCGG + Intergenic
922033124 1:221823721-221823743 AACCTTGGAAATAAGCAACTAGG - Intergenic
923999791 1:239537742-239537764 CCCTTTGCAAAAAAGAAATTAGG - Intronic
924217720 1:241841353-241841375 CAGTTTTCAAATAAGGAAAATGG + Intergenic
1063566207 10:7173935-7173957 CATTTTGTAAGTAAGGAAATTGG - Intronic
1064792887 10:18978898-18978920 CATTATTCAAATAAGGCACTAGG - Intergenic
1064926479 10:20574858-20574880 CAGTTTGCAAAAAAGAAACAGGG - Intergenic
1065710279 10:28509545-28509567 CACTCTACAAATAAGGAAACTGG - Intergenic
1065984485 10:30936190-30936212 CATTTTGCAAATGAGCAAATCGG - Intronic
1066387552 10:34954006-34954028 TATTTTGCAGACAAGGAACTGGG - Intergenic
1067135334 10:43602578-43602600 CATTTTGCAGATGAGGAAATTGG - Intergenic
1067897319 10:50197636-50197658 CATTTTGCAAATGAGAAAATAGG + Intronic
1067951653 10:50744384-50744406 CATTTTGCAAATGAGAAAATAGG - Intronic
1068729872 10:60345204-60345226 CATTTTGAAAATAAGCAAATGGG + Intronic
1069307806 10:66993412-66993434 CACTTTGCTAAAAAGTACCTGGG + Intronic
1069777962 10:70937807-70937829 CAGTTTACAGATAAGGAAATAGG - Intergenic
1069824849 10:71248679-71248701 CACTTTGAAAACAAAGACCTTGG - Intronic
1069852947 10:71422386-71422408 CACTTTGCAGATGAAGAAATGGG - Intronic
1070400667 10:76050870-76050892 CACCTTTCAAATAAGGGAGTTGG + Intronic
1071126001 10:82335488-82335510 CATTTTACAAATAGGGAAATTGG + Intronic
1071251147 10:83821100-83821122 CCCTTGTCAAATCAGGAACTAGG - Intergenic
1071779301 10:88825233-88825255 TACTTTTTCAATAAGGAACTGGG + Intronic
1071829749 10:89360003-89360025 CATTTTGCAAATGAAGAATTTGG + Intronic
1071951606 10:90709568-90709590 CAGTTGGCAAATAAGAAACCAGG + Intergenic
1072133209 10:92516911-92516933 TACCTTGCAAATTAGGGACTGGG + Intronic
1072253231 10:93598347-93598369 CACTTTGCAGATGACGAAATAGG + Intronic
1072321205 10:94251972-94251994 TACTTTGCAAATTAGGGCCTTGG - Intronic
1072537941 10:96377520-96377542 CACTTCCCAAATAAGAAAATAGG + Intronic
1073045213 10:100633636-100633658 CATTTTGCAAATGAAGAAATTGG + Intergenic
1073046728 10:100643555-100643577 CACTTAACAGATAAGGAAATAGG + Intergenic
1074506872 10:114078929-114078951 CACTTTGCAAGTAAGGAGGCTGG - Intergenic
1074914798 10:117945260-117945282 CAGTTTTAAAATGAGGAACTGGG + Intergenic
1075214533 10:120520579-120520601 CACCTGTCAAACAAGGAACTTGG + Intronic
1075389930 10:122084720-122084742 CACATTGGAAATAAGGAAGATGG + Exonic
1075504667 10:123011299-123011321 CATCTTGCAAATGAGGAACTCGG + Intronic
1076633418 10:131866909-131866931 CACTTTGCAATTACGGAATATGG - Intergenic
1077898461 11:6472215-6472237 CAATTTACAAATAAGGGAATGGG - Intronic
1079194373 11:18312614-18312636 CCCTTGGCAACTAGGGAACTGGG - Intronic
1079431165 11:20389266-20389288 CACTTTTGAAATAAGGCACTTGG + Intronic
1079794499 11:24782958-24782980 CTCTTTGCAAGTAAGCAACTTGG - Intronic
1080336823 11:31207123-31207145 CATTGTGCAAATGAGGAAATAGG - Intronic
1080400635 11:31932090-31932112 CATTTTGCAGATAAGGAAATTGG - Intronic
1080638559 11:34144668-34144690 CACTCTGCAGATAAGAAGCTTGG - Intronic
1081169051 11:39844466-39844488 CAGTTTTCACTTAAGGAACTAGG - Intergenic
1081257777 11:40918486-40918508 CACCTGGCAAATAAGGGAATTGG - Intronic
1082207357 11:49454096-49454118 TATTTTACAAATAAGGAAATTGG - Intergenic
1083108201 11:60378817-60378839 CACTTGTCAAATAAGAAAATTGG + Intronic
1084352012 11:68608892-68608914 AACTTTACAAAGAAGGAACCAGG + Intronic
1085467279 11:76732757-76732779 AACTTTACAGATGAGGAACTGGG + Intergenic
1086016743 11:82177196-82177218 CATTTTACAAATAAAGAAATTGG - Intergenic
1086593022 11:88538789-88538811 TACTTTACAAATGAAGAACTAGG + Intronic
1087106489 11:94414068-94414090 CACTTTTATAAAAAGGAACTTGG + Intergenic
1087396501 11:97607845-97607867 CATTTTGCAAATAAGAAAGCAGG - Intergenic
1088833270 11:113556271-113556293 CACTTTGCATATAAGGAAATGGG - Intergenic
1089217935 11:116847012-116847034 CACTTTACAGATGAGGATCTCGG + Intronic
1090480816 11:127066751-127066773 CACTTAGTAAATAAGGAGGTGGG - Intergenic
1090584349 11:128194262-128194284 CATTTAGAAAAAAAGGAACTTGG + Intergenic
1090652999 11:128823652-128823674 CACTTTACAAGTAAGGGACACGG + Intergenic
1091461312 12:645530-645552 CATTTTGCAGATAAGGAAAAGGG + Intronic
1091562418 12:1625165-1625187 CACATTGGAAATAAAGAACTGGG + Intronic
1091565339 12:1644044-1644066 CACTTTGCCACTTAGCAACTCGG - Intronic
1092174354 12:6392850-6392872 TACTTTTCAAAAAAGGAAGTTGG - Intergenic
1092196647 12:6553825-6553847 CACTTTGCAATTATTGAAATGGG + Intronic
1092662473 12:10754148-10754170 CACTTTGTAGATGAGAAACTAGG - Intergenic
1092764147 12:11837461-11837483 CACTTTGCAAAGGAGCCACTTGG + Intronic
1093182147 12:15978956-15978978 CATTTTGTAAATGAGGAACATGG + Intronic
1093663494 12:21784900-21784922 CCTTTTGCAAATGAGGAAATGGG + Intergenic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1093964706 12:25312137-25312159 CACTTTACAGCTAAGGAAGTGGG + Intergenic
1094597928 12:31882300-31882322 CATTTTACAGATAAGGAACCAGG + Intergenic
1095137200 12:38619382-38619404 CACTTTGGAAATTAAGAAGTGGG - Intergenic
1095604958 12:44055617-44055639 CACTTTACAAATGAGGAAAATGG - Intronic
1096086658 12:48869665-48869687 CACATTGCATTTAAGGAAATAGG - Intergenic
1097490056 12:60255748-60255770 CACTATGTAAAGAAGGAACATGG - Intergenic
1097493171 12:60295999-60296021 CTCTTTGCAAATAGGTAATTTGG + Intergenic
1098124621 12:67277759-67277781 GAATTTGCAAATATGGAACCTGG + Intronic
1098958967 12:76718518-76718540 CATTTTACAGATAAGAAACTGGG + Intergenic
1099622300 12:85019195-85019217 CACTTTACGAATGTGGAACTTGG + Intronic
1099642106 12:85303670-85303692 CACTGTGTAAAAAAGGAAGTTGG - Intergenic
1099943595 12:89219295-89219317 GATTTTGCAAATAAAGAATTTGG + Intergenic
1100440319 12:94610992-94611014 CACTTTGAAATTCAGGCACTGGG - Intronic
1100440917 12:94616312-94616334 CTCTTTACCAATAAGGAAATGGG + Intronic
1101363388 12:104048871-104048893 CATTTTACAGATGAGGAACTAGG + Intronic
1101498567 12:105279588-105279610 CATTTTACAAATAAGGAAACTGG + Intronic
1101650302 12:106671594-106671616 CACTTTACAAATGAGGAACTGGG - Intronic
1102012286 12:109626163-109626185 CACTTTGCAGATGCGGAAATAGG + Intergenic
1102405166 12:112667088-112667110 CACTCTGCTTTTAAGGAACTTGG - Intronic
1102792687 12:115660493-115660515 TCCTTTACAAACAAGGAACTGGG - Intergenic
1102897589 12:116611078-116611100 CACTTTACAAGTAAGGAAGTAGG + Intergenic
1103334977 12:120182582-120182604 CACTTTGCAAATGAGGAAATGGG + Intronic
1103600326 12:122050650-122050672 CATTTTACAAACAAGGAAGTAGG - Intronic
1103718690 12:122961792-122961814 CATTTTGCAAATGAGGAAACAGG - Intronic
1103821539 12:123702603-123702625 CCGTTTGCAAATGAGGATCTAGG - Intronic
1104373273 12:128243034-128243056 CAGAGTGCAAAAAAGGAACTGGG - Intergenic
1104465861 12:128989883-128989905 CATTTTACAAATGAGGATCTTGG - Intergenic
1105603030 13:21903856-21903878 CAGTGTGCAAATCAGAAACTTGG - Intergenic
1106259867 13:28056951-28056973 CATTTTACCAATAAGGAAATCGG + Intronic
1106951293 13:34887030-34887052 TACTTTATAAATAAGAAACTTGG + Intergenic
1107686283 13:42902745-42902767 CACCTTACAGATAAGGAAATGGG + Intronic
1107821286 13:44288107-44288129 CACTTCACAAATAAGAAAATTGG + Intergenic
1110297845 13:73889452-73889474 CACTTTGCACATCAAGAAATGGG + Intronic
1111455437 13:88477224-88477246 AAATTTGGAAATAATGAACTAGG + Intergenic
1112032434 13:95470097-95470119 AACCCTGCAAATATGGAACTAGG + Intronic
1112198875 13:97255680-97255702 CACTTTGCAAATAGGAAAGCTGG + Intronic
1112775708 13:102842239-102842261 CACTTTACTAATGAGGAAATAGG - Intronic
1115981786 14:39060172-39060194 CAGATTTCAGATAAGGAACTTGG - Intronic
1116065414 14:39975738-39975760 CTTTTTGAAAATAAGGAATTGGG - Intergenic
1116201091 14:41797496-41797518 CACTTTTCCAATAAGGTATTAGG - Intronic
1117816192 14:59600383-59600405 CAATTTACAGATAAGGAAATAGG + Intronic
1118042689 14:61934724-61934746 CACTTTGCAGGTAAGGAAACAGG - Intergenic
1118519134 14:66561526-66561548 CATTTTACATATAAGGAAATTGG + Intronic
1119537330 14:75413228-75413250 CACTCTGCAAATGAGGAAACTGG - Intergenic
1120191916 14:81447289-81447311 CACTTAGTAACTATGGAACTAGG - Intergenic
1120368164 14:83596882-83596904 CACTTTACAAATGAGACACTGGG - Intergenic
1121002114 14:90459043-90459065 CACTTTGCAGGTAAGGAAACAGG - Intergenic
1122712843 14:103672682-103672704 CATTTTGAAGATAAGGAAATGGG - Intronic
1123813433 15:23952748-23952770 CACTCACCAAAAAAGGAACTAGG - Intergenic
1125036514 15:35130981-35131003 TAGTTTGCAGATAAGGACCTGGG + Intergenic
1125367670 15:38936166-38936188 CACCTTGCAATTAAGGAATATGG - Intergenic
1125500539 15:40238214-40238236 CACCTTGGATATAAGGGACTGGG + Intergenic
1126347142 15:47708225-47708247 CACATGCCAATTAAGGAACTTGG + Intronic
1126683147 15:51223672-51223694 TACTTTGCAAATAAGAAAGGAGG + Intronic
1127595412 15:60477486-60477508 AACTTTGCAAATAGAGAACCTGG - Intronic
1127755447 15:62087523-62087545 CATTTTCCAGATAAGGGACTGGG + Intergenic
1128207555 15:65866644-65866666 CATTTTGCAGGTAAGAAACTGGG + Intronic
1128771497 15:70285994-70286016 CACATTACAAATAAGGAACCGGG - Intergenic
1128796122 15:70467952-70467974 CACTTTAAAAAGGAGGAACTGGG + Intergenic
1129532934 15:76283490-76283512 CACTTTAAAAATAATGAAATGGG - Intronic
1130801686 15:87271031-87271053 CATTCTTCAAAAAAGGAACTAGG + Intergenic
1130898608 15:88190065-88190087 CACTTGGCAAGACAGGAACTCGG + Intronic
1131372227 15:91892156-91892178 CACTTTGCAAATGAGGAAACAGG + Intronic
1131633373 15:94203542-94203564 TACTTGACCAATAAGGAACTGGG + Intergenic
1131854903 15:96583349-96583371 TCCTTTGCAAATGAAGAACTTGG + Intergenic
1131974037 15:97924154-97924176 CACTCTGCAAAAAAAGATCTGGG + Intergenic
1132137910 15:99361834-99361856 CAAGTTTCAAGTAAGGAACTTGG + Intronic
1133185226 16:4091373-4091395 CACTTTTAAAATGAGGAACTTGG - Intronic
1134387256 16:13785049-13785071 CACTTTACTAATGAGGAAATTGG + Intergenic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1134878455 16:17723405-17723427 CATTTTGCAAATTTGGAATTTGG + Intergenic
1135173473 16:20207664-20207686 CTCTTCTCAAATAAGTAACTGGG + Intergenic
1135892720 16:26371994-26372016 CTCTTCAAAAATAAGGAACTAGG + Intergenic
1136935906 16:34464629-34464651 CACTCTGAAAATAATGAACAGGG + Intergenic
1136963914 16:34883941-34883963 CACTCTGAAAATAATGAACAGGG - Intergenic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1137311855 16:47270055-47270077 CAATTTACAAAAAAGGAACTCGG + Intronic
1137527288 16:49247349-49247371 CTCTTTCCAAATTAGGCACTCGG - Intergenic
1137560285 16:49497857-49497879 CACTTAGCAAACAAGGCACCTGG + Intronic
1138206957 16:55132413-55132435 CACTTTACAAATGAGGAAAATGG + Intergenic
1138723441 16:59109518-59109540 CACTTTGCAAATGAAAAACAAGG - Intergenic
1139816270 16:69675939-69675961 CACATTATAAATAAAGAACTAGG - Intronic
1140555717 16:75918841-75918863 CACTCTGTATATGAGGAACTGGG - Intergenic
1140649082 16:77066903-77066925 CATTTTACAAATAAGGAAACAGG + Intergenic
1141117052 16:81317577-81317599 CACTTTCTAAATAAGAAAATAGG + Intronic
1141311924 16:82922300-82922322 AACTTTTCACATAAGTAACTAGG + Intronic
1141326677 16:83066545-83066567 CTCTTTGCAAATTAAGAAATTGG - Intronic
1141635082 16:85310264-85310286 CACTTTGCACATCTGGAAATGGG + Intergenic
1141764150 16:86047591-86047613 CACTTTGCAGATGAGGAAAATGG + Intergenic
1142429258 16:90017761-90017783 CACTTTGCAGACAAGGAAACAGG + Intronic
1142583582 17:956787-956809 CACTTTACAGATGAGGAAGTGGG + Intronic
1145085437 17:19934687-19934709 CACTTTACAGATAAGGAAAATGG + Intronic
1145277072 17:21438102-21438124 CACCTTGAAAAAAATGAACTGGG + Intergenic
1145314905 17:21723995-21724017 CACCTTGAAAAAAATGAACTGGG + Intergenic
1145713343 17:26995932-26995954 CACCTTGAAAAAAACGAACTGGG + Intergenic
1146096834 17:29938039-29938061 CACCTTTCAATTAAGGAACTGGG + Intronic
1146392346 17:32434251-32434273 CATTTTACAAATAAGGACCCTGG + Intergenic
1146836529 17:36115179-36115201 CACTTTGCGGTTAAGGAAGTGGG + Intergenic
1146983254 17:37186036-37186058 CATTCTGCCAATAAGGAACAAGG - Intronic
1147323999 17:39661764-39661786 CATTCTGCAGATAAGGAAGTTGG - Intronic
1148336289 17:46843679-46843701 CATTTTACAAATGAGGAAATGGG - Intronic
1149405810 17:56349875-56349897 CACTTTGCACATAATTACCTTGG + Intronic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1152133986 17:78493485-78493507 CAGTTTCCTAAAAAGGAACTCGG - Intronic
1153519885 18:5941657-5941679 CACTTTACAGATGCGGAACTTGG - Intergenic
1153680121 18:7492534-7492556 CATTTTACAAATGAGGAAATTGG - Intergenic
1155761289 18:29570692-29570714 GACTTTGAAACTAAGGAATTTGG - Intergenic
1155846367 18:30712804-30712826 CATTTGGCAAATGAGGAATTAGG - Intergenic
1156264771 18:35477628-35477650 CCTTCTGCAAATAAGGAAATGGG + Intronic
1156399310 18:36726586-36726608 AAATTTGAAAATAAGGAAATTGG - Intronic
1156550663 18:38012927-38012949 AACTTTGCATAAAAGGAAATAGG - Intergenic
1157918168 18:51690269-51690291 CACTTTTCAGATAAGGAAACTGG + Intergenic
1158072134 18:53484627-53484649 CACATTGAAAATAATGAAATTGG - Intronic
1158205131 18:54984589-54984611 CAATTTGGAAATAAATAACTGGG + Intergenic
1162354035 19:10169857-10169879 CACCTTCCAAAGAAGGAACCTGG - Intronic
1164437098 19:28240084-28240106 CATTATGAAAATCAGGAACTTGG - Intergenic
925688155 2:6493882-6493904 CATTTGGTAAATAAAGAACTGGG + Intergenic
928458321 2:31445467-31445489 CTTTCTGGAAATAAGGAACTTGG - Intergenic
928515933 2:32044984-32045006 CACATGGCAAACAAGGAACCAGG - Intergenic
928550205 2:32362895-32362917 CATTTTGCAAATAAGGAAACTGG - Intronic
929582065 2:43087663-43087685 CATTTTCCAGATAAGGAAGTTGG + Intergenic
929847977 2:45552622-45552644 CACTTTAAAAATTAGGAATTTGG - Intronic
930024137 2:47020184-47020206 CATTTTGCAGATGAGGACCTTGG + Intronic
930217801 2:48714875-48714897 CATTTTGCAAAGAAGGAAATAGG + Intronic
930243876 2:48963609-48963631 CAGGTTGCACATAAGGAACCTGG + Exonic
933204325 2:79488003-79488025 CACTTTAAAAATGAAGAACTAGG - Intronic
933295126 2:80481339-80481361 CATTTTACAAACGAGGAACTTGG - Intronic
933663594 2:84946745-84946767 CCTTTGGCAAATGAGGAACTAGG + Intergenic
934989386 2:98910799-98910821 CACTTTGCAGAAAAGGAAATGGG - Intronic
935623667 2:105150502-105150524 CACTTTACAGATAAGGAAGAAGG + Intergenic
936434614 2:112493445-112493467 CATTTCACAAATTAGGAACTGGG - Intronic
937176982 2:119947992-119948014 CTTTTTTCAAATAAGGAAATAGG - Intronic
937344271 2:121114466-121114488 CATTTTAAAACTAAGGAACTCGG + Intergenic
938161135 2:128985411-128985433 CATTTTACAAGTAAGGAACTGGG - Intergenic
938225247 2:129610148-129610170 CACTTTGACAATAAGGATCTTGG + Intergenic
938509984 2:131931256-131931278 CACCTTGTAAAGAAGGTACTTGG - Intergenic
939108224 2:137974988-137975010 CACTTCACAAATAAGAAACCTGG + Intronic
939392461 2:141586200-141586222 CACTATGAAAATAAGGGATTTGG - Intronic
939800275 2:146699489-146699511 CACTTGGGAAATAATAAACTGGG + Intergenic
940169470 2:150812162-150812184 CACTTTGGAAAGTAGTAACTTGG - Intergenic
940191195 2:151041913-151041935 CAATTTGCAATTACGTAACTAGG - Intronic
940689211 2:156894163-156894185 CACTTAGCAGATAAGGAATTTGG + Intergenic
940696929 2:156991502-156991524 CTCTTTGTGAATAAAGAACTAGG - Intergenic
940789805 2:158020278-158020300 CACTTTGCAAAGGAGGACCATGG - Intronic
941973277 2:171375326-171375348 CACTATGCTAACGAGGAACTTGG - Intronic
942310579 2:174653098-174653120 CATTTTACAAATAAGGAAACTGG + Intronic
943392414 2:187285843-187285865 CAGTTTGCAGATAAGGAAATGGG - Intergenic
943539339 2:189192457-189192479 CATTATGCAAATAAGGAATTGGG - Intergenic
943707561 2:191051431-191051453 CATTTTGTAGATAAGGAAATTGG + Intronic
943742517 2:191425953-191425975 CAATCTGCAAATAAGGTATTTGG - Intergenic
945250829 2:207765523-207765545 CACTTTGCAATTAGAGAATTTGG - Exonic
945512777 2:210723357-210723379 CAAATTGGCAATAAGGAACTTGG - Intergenic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
946420103 2:219560165-219560187 CATTTTCCATATAAGGGACTGGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947956380 2:234195706-234195728 CTCTTTGCAAATAGGAAACAGGG - Intergenic
1168812964 20:718213-718235 CATTTTGCAAATGAGGAAACAGG - Intergenic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1169555680 20:6746984-6747006 CATTTTGCAAATGAGGAAACTGG + Intergenic
1169818713 20:9685936-9685958 CACTTTGCTAATCAAGAAGTTGG - Intronic
1170028978 20:11924269-11924291 AAATTGGAAAATAAGGAACTGGG + Exonic
1171757400 20:29123467-29123489 CACATGAAAAATAAGGAACTTGG - Intergenic
1172313551 20:33936084-33936106 CCCTTTCCAAATATTGAACTTGG - Intergenic
1172335008 20:34108398-34108420 CAGTTTACAAATAAGGACCAGGG + Intronic
1172858894 20:38032067-38032089 CACTTGATAAATCAGGAACTGGG + Intronic
1173102674 20:40101789-40101811 CATTTTACAAATAAGGAAACTGG - Intergenic
1173224034 20:41151506-41151528 CATTTTACAAACAAGGATCTGGG - Intronic
1173423632 20:42924709-42924731 CACTTTTCAGATAAGGAAATGGG + Intronic
1173453516 20:43186178-43186200 CACTTTACAAATGAGAAGCTGGG + Intronic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1174920640 20:54698098-54698120 CACTTTCCAAATAATTAATTTGG + Intergenic
1176695276 21:9969794-9969816 TACTTTCCAAATAAAAAACTAGG + Intergenic
1177233136 21:18348963-18348985 CACTTTCCAGATAAGGGAATTGG + Intronic
1177253567 21:18629442-18629464 CATTGTGAAAATAAGGAACAGGG + Intergenic
1177860823 21:26451746-26451768 CAATTTGCAAGTGAGGAAATTGG + Intergenic
1177981544 21:27921127-27921149 CACCTTGTAAAGAAGGTACTTGG + Intergenic
1179295355 21:40057154-40057176 TGCTCTGCAGATAAGGAACTGGG + Intronic
1179446133 21:41432052-41432074 TACTTTGCAAAGAAGGAAGATGG + Exonic
1179883153 21:44301791-44301813 CACTTTGCAAACAAGGAAGCTGG - Intronic
1181266476 22:21633808-21633830 CACTTTGCAGATGAGGACATTGG + Intronic
1182065847 22:27431170-27431192 CATTTTGCAAATGAAGAGCTTGG - Intergenic
1182417566 22:30231259-30231281 CACTTTGCATACGAGGAAATGGG + Intergenic
1182753851 22:32662590-32662612 CATTTTACAGATGAGGAACTTGG - Intronic
1182780866 22:32866413-32866435 CATTTTGCAGACAAGGAAATTGG + Intronic
1183083547 22:35472748-35472770 CATTTTACAAATAAGGAAACAGG - Intergenic
1183202001 22:36391804-36391826 CATTTTGCAGATAAGGAAACAGG - Intergenic
1184617758 22:45649629-45649651 CATTTTGCAGGTGAGGAACTTGG + Intergenic
1185376974 22:50487167-50487189 CGCTTTGCAGATGAGGACCTGGG + Intronic
950486111 3:13274823-13274845 TGCTTTGCAGAGAAGGAACTTGG + Intergenic
950728800 3:14937986-14938008 CATTTTGCACGTAAGGAAATGGG + Intergenic
951622731 3:24623996-24624018 TACTTTTTAAATAAGGATCTTGG + Intergenic
951826184 3:26871767-26871789 CATTTTGCAAATAAGGAAAACGG + Intergenic
952231864 3:31439837-31439859 CACATTGCAAATAAGGCAACAGG - Intergenic
952350367 3:32530007-32530029 CATTTTGCAGATGAGGAAATGGG - Intronic
952378854 3:32788851-32788873 TATTTTACAAATAAGGAAATTGG - Intergenic
952824881 3:37516408-37516430 CACTTTACAGATGAGGAAATTGG - Intronic
953689739 3:45107650-45107672 CACTTTACAGATGAGCAACTGGG + Intronic
954056798 3:48033049-48033071 CACTTTTAAAATAAGGAGGTTGG - Intronic
954649021 3:52148806-52148828 CATTTTGCAGATGAGGAAATGGG - Intronic
955157364 3:56429779-56429801 CCCTTTGCACATAAGAAATTTGG + Intronic
955368495 3:58331866-58331888 CACTTTGCAAATTGGGGAGTTGG + Intergenic
955692522 3:61604599-61604621 CATTTACCAAATAAGGAATTTGG + Intronic
956077022 3:65516672-65516694 CACTTTTCAAATGAGGATTTGGG + Intronic
957288989 3:78252676-78252698 CACTTTGAACATAAGGACATAGG + Intergenic
960070083 3:113419775-113419797 CTTTTTGCAGATAAGGAAATGGG - Intronic
960151246 3:114251083-114251105 CATTTTGCAGATGAGGAAATGGG - Intergenic
960749393 3:120930020-120930042 CAAGATGCAAATAATGAACTGGG - Intronic
961606154 3:128096916-128096938 CATTTTTCAAATAAGGAAACTGG - Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962713457 3:138107120-138107142 CATTTTACAAATAAGGAAACTGG + Intronic
962729812 3:138270982-138271004 CACTTTACAAATGGGAAACTAGG + Intronic
963246140 3:143065171-143065193 CACGCTGCAAATGAGGAAATGGG - Intergenic
963859768 3:150297110-150297132 CAGCTGGCAAATAAGGAGCTCGG - Intergenic
964273763 3:154986943-154986965 CACCTTCCCAATAAGAAACTAGG + Intergenic
964390373 3:156190583-156190605 CATTTTGCAGATGAGGAACCAGG - Intronic
965969430 3:174535624-174535646 TACTTTACAGATAAGGAAATTGG + Intronic
966626582 3:182023425-182023447 CATTCTGGAAATAAGGAACATGG - Intergenic
966857999 3:184209191-184209213 CACTTTGCAATGAAGGAGCCTGG + Intronic
967119076 3:186366558-186366580 CACTTTGCAGAAGAGGAAATTGG - Intergenic
967138692 3:186534337-186534359 CAGTTTACAGATGAGGAACTGGG - Intergenic
967290792 3:187918087-187918109 AACTTTGCAGATAAGAAAATCGG + Intergenic
967296149 3:187967122-187967144 CATTTTACAAATGAGCAACTAGG - Intergenic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
967460412 3:189739634-189739656 CACTTTATAAATGAGGAACTGGG - Intronic
967518600 3:190400966-190400988 CATTTTACAAATGAGGAAATTGG - Intronic
967635300 3:191794261-191794283 CTCTTTTCAAATTAGAAACTAGG + Intergenic
967970100 3:194993387-194993409 CACTTTAGAAATAGGGAATTGGG - Intergenic
968676605 4:1884690-1884712 CAATTTGCAGATAAAGAACGAGG - Intronic
969175437 4:5395357-5395379 CATTTTGCAGATGAGGAAGTAGG - Intronic
969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG + Intronic
969428680 4:7140485-7140507 CATTTTCCAAATGAGGAAATAGG + Intergenic
969467372 4:7365818-7365840 CACTTTGCAAAGAAGGTGCCTGG - Intronic
971071070 4:23092326-23092348 CATTTTGCAGATGAGGAAATTGG - Intergenic
971646946 4:29218800-29218822 CATTTTGTAAATGAGGAAATTGG + Intergenic
973655184 4:53039763-53039785 CATTTTACAAATAAGGAAGTTGG + Intronic
973676991 4:53274193-53274215 CATTTTGCAAGTAAGGAAACAGG + Intronic
973899446 4:55452709-55452731 CACTTTGAAAATACTGAAATTGG - Intronic
973960216 4:56102400-56102422 CATTTTACAAATGAGGAAATGGG + Intergenic
974054716 4:56974136-56974158 CACTTTACAAATGAGGAAATAGG + Intronic
974204878 4:58688841-58688863 CACTCTGCAAATATAAAACTAGG - Intergenic
976440016 4:85062271-85062293 CACTTTGCAGATGAAGAAATTGG + Intergenic
976465945 4:85368826-85368848 CCCTTTACAAATAAGAAAATAGG + Intergenic
976855378 4:89598392-89598414 CACTGTGCATATGATGAACTAGG - Intergenic
977311250 4:95390565-95390587 CATTATGGAAATAAGGAAATAGG - Intronic
977316178 4:95450736-95450758 CCTTTTTCAAATAAGCAACTTGG - Intronic
977915017 4:102582342-102582364 CACTTTGCAAAAGAGAAACTGGG - Intronic
978037755 4:104017106-104017128 CACTCTGAAAATTAGGAACTGGG + Intergenic
978144582 4:105356842-105356864 CACTTTACATCTAAGGAAATAGG - Intergenic
979418430 4:120473147-120473169 CATTTTTCAAATAATGAAGTTGG - Intergenic
979788106 4:124742340-124742362 CACTTTGCAAATGAAGAAATTGG - Intergenic
979806977 4:124986210-124986232 CACTCTGCAAATAACCAACTGGG - Intergenic
980327959 4:131372700-131372722 TAGTTTGCAAATATGGATCTTGG - Intergenic
980367901 4:131830024-131830046 TACTTTCCAAATAAAAAACTAGG + Intergenic
980940497 4:139269927-139269949 CAATTTTTAAATAAGGTACTTGG - Intronic
981759756 4:148181382-148181404 CATTTTACAGATAAGGAATTTGG - Intronic
981765299 4:148241675-148241697 CAATTTGCAAATAAGCAAACAGG - Intronic
981886265 4:149676569-149676591 CACAGTGCAATTAAGTAACTTGG + Intergenic
981936874 4:150248626-150248648 CATTTTGCAGATAAGGAAACTGG - Intronic
983803613 4:171966262-171966284 CACTTTCCACATTAAGAACTAGG - Intronic
984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG + Intergenic
984580648 4:181506131-181506153 TACTCTGCAAATAATGACCTAGG + Intergenic
984941703 4:184938372-184938394 CCCTTTGCAAATGAAGAATTTGG + Intergenic
984999539 4:185470704-185470726 CATTTTGCAGATAAGGAAACGGG - Intronic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
986681712 5:10239264-10239286 CAGTTTGCAGAAAAGCAACTGGG - Exonic
986735238 5:10663158-10663180 CACTTTACAAATGAGGACCCTGG - Intergenic
986979933 5:13435623-13435645 TACTTTGCATATGAGGAACATGG + Intergenic
988407507 5:30842314-30842336 AATTTTGCAGATAAAGAACTGGG + Intergenic
988503889 5:31805284-31805306 CACTTTGCAATTTAGGTAGTAGG + Intronic
989351247 5:40489185-40489207 CTCTTTGCAAAGAAGCAACTAGG - Intergenic
990285362 5:54296384-54296406 CACTTTGCATACAAGGAAACAGG + Intronic
992466014 5:77005598-77005620 CATTTTGCAAATGAGGTAGTAGG + Intergenic
993907110 5:93635230-93635252 TACTTTACAATGAAGGAACTTGG - Intronic
994294831 5:98078394-98078416 CATTTTACAAATAAGGAAAGTGG + Intergenic
997135876 5:131325371-131325393 CACTTTTTAAATTAGAAACTTGG + Intronic
997732198 5:136189994-136190016 CATTTTGCAGATGAGGAAATAGG + Intergenic
997888111 5:137649691-137649713 CATTTTGCAGATGAGGAAGTTGG - Intronic
998563743 5:143196929-143196951 GAATTTGCAAATAAGGAATATGG + Intronic
998708848 5:144797664-144797686 CACTTTACAGAAAAGAAACTGGG + Intergenic
999492118 5:152061460-152061482 CAGTTTGCAGATAAAGAAATTGG + Intergenic
999635190 5:153614491-153614513 CGTTTTGCAAATAAGGAAACTGG + Intronic
1000297700 5:159926583-159926605 CATTTTATAAATAAGGAAATGGG + Intronic
1002403460 5:179008498-179008520 CAGTTTGCAAATATTGGACTAGG - Intergenic
1003693593 6:8379340-8379362 CACTTTGGAAATAAGGCAAAAGG - Intergenic
1004481615 6:16024806-16024828 CACTTTACAAGTAAGAAACTGGG + Intergenic
1004900869 6:20192756-20192778 CATTTTGCAGATAAGGAATCAGG + Intronic
1005010763 6:21333252-21333274 CATTTTACAGTTAAGGAACTTGG + Intergenic
1005099688 6:22157399-22157421 CATTTTGCAGATAAGGAGATTGG + Intergenic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1006737071 6:36281524-36281546 CACTTTACAAATGAGGAAACAGG + Intronic
1006764270 6:36490888-36490910 CACTTTGCAATTATTGAAATGGG + Exonic
1006969143 6:38022596-38022618 CATTTTTCAAATGAGGAAATAGG + Intronic
1007261899 6:40569767-40569789 CAATTTGCCTTTAAGGAACTTGG - Intronic
1007636316 6:43301895-43301917 CCCTTTCCAAGTAAGGAAGTGGG - Intronic
1007864236 6:44950677-44950699 CACTAACCATATAAGGAACTGGG - Intronic
1008036719 6:46753183-46753205 TAATTTGCAAATGAGGAAATTGG + Intronic
1008813971 6:55540502-55540524 CCATCTGCAAATAAGGAAGTGGG + Intronic
1009313245 6:62184436-62184458 CACTTTCCAAATAAAGAAACGGG + Intronic
1009326162 6:62349973-62349995 CACTTAGCTACAAAGGAACTTGG + Intergenic
1009585308 6:65593928-65593950 CATTTCACAAACAAGGAACTTGG + Intronic
1011696765 6:89920186-89920208 CATTTTACAGATAAGGAAATAGG + Intergenic
1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG + Intergenic
1012370499 6:98500176-98500198 CATTTTACAAATAAGGAATATGG - Intergenic
1013556356 6:111260383-111260405 AATTTTGCAGATAAGGAAATAGG + Intronic
1014121336 6:117728648-117728670 CATTTTGCAGATAAGGAAATGGG + Intergenic
1014894839 6:126889216-126889238 AACATTCCAAATAAGGCACTGGG + Intergenic
1015292133 6:131549270-131549292 CCCTGTGGAAATAAGAAACTAGG - Intergenic
1015551553 6:134417643-134417665 TAATTTTCAAATAAGGAAATTGG - Intergenic
1015858129 6:137647450-137647472 CACTTTGCAAGTGAGGAAATGGG - Intergenic
1015973285 6:138763923-138763945 CTCTTTACAGATAAGGAAATTGG - Intronic
1016198958 6:141384216-141384238 AACTATGCAAATAATGAACTAGG + Intergenic
1016546225 6:145227631-145227653 CACTTTGAAAATAGGAAACTGGG + Intergenic
1017137515 6:151161374-151161396 CACTTTGGAGAGAAGGAACAGGG - Intergenic
1017189543 6:151637408-151637430 CATTTTCCAAATAAGGACATGGG - Intergenic
1018774956 6:167006056-167006078 CATGTTGCAGATAAGGAACCTGG - Intronic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1020161313 7:5774239-5774261 CATTTTACAAATGAGGAAATTGG - Intronic
1020893739 7:13913439-13913461 CACTTTACAGATGAGGAAGTTGG - Intronic
1020978824 7:15042182-15042204 ATCTTTGTAAACAAGGAACTTGG + Intergenic
1022172007 7:27840041-27840063 AACTTTTCTAATAAGGAACAGGG - Intronic
1023840464 7:44094336-44094358 TATTTTACAAATAAGGAAATTGG - Intergenic
1023883373 7:44334363-44334385 CACTTTGCAAATGAGGACACTGG + Intronic
1024303600 7:47907357-47907379 CACTTTGCAACAAAGCAAATGGG - Intronic
1026118336 7:67515116-67515138 CAATTTGCAAACCAGAAACTGGG + Intergenic
1026788373 7:73316325-73316347 CACTTTACAGATGAGGAACCTGG + Intronic
1027629932 7:80591049-80591071 CAATTTGTGAATAAGGAAATGGG + Intronic
1027875576 7:83763696-83763718 GACTTAGCAAATAAGTCACTAGG + Intergenic
1028194166 7:87886221-87886243 CACTTTTTAAATAAAGTACTAGG - Intronic
1029942954 7:104499268-104499290 CATTTTGCAAATGAGCAAATAGG - Intronic
1030680866 7:112432589-112432611 CATTTTACAAATGAGGAAATGGG + Intronic
1030948611 7:115759834-115759856 TATTTTGCAAATGAGGAAATAGG + Intergenic
1031438034 7:121756963-121756985 CACTTTAAAAACAAGGAAATGGG + Intergenic
1032171199 7:129586000-129586022 CACTTTCCAAATAGGGATCCAGG - Intergenic
1032716405 7:134512641-134512663 CACTTTGAAAAAAAGGAAATTGG - Intergenic
1033944453 7:146699081-146699103 AACTTTGCAATTATTGAACTGGG - Intronic
1037635354 8:20697006-20697028 CATTTGGCAAATAAGGAAAATGG - Intergenic
1038516997 8:28195757-28195779 CATTTTACAAATGAGAAACTCGG + Intergenic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1038755192 8:30334112-30334134 CAATTTGAAAATAAGGAAAGCGG + Intergenic
1039100202 8:33933213-33933235 CTATTTGCAAATAAGGAAACTGG + Intergenic
1039268876 8:35858803-35858825 CATTTTACAAATGAGAAACTGGG + Intergenic
1039701276 8:39964325-39964347 CATTTTATAAATAAGGAAATGGG - Intronic
1039755131 8:40514518-40514540 CACTTTGTAAATATGATACTTGG - Intergenic
1039864178 8:41486989-41487011 CTATTTGCAAATAAGGATCTGGG - Intergenic
1040453112 8:47568074-47568096 CATTTTGAAAATAAGAAAATAGG - Intronic
1040804021 8:51374240-51374262 CACTTTACAGATGAGGAACCTGG + Intronic
1041206077 8:55498894-55498916 CACTTTGTAGATGAGGAAATTGG + Intronic
1041271878 8:56116999-56117021 CATTTTGCAGATAAGGAAACAGG - Intergenic
1042181820 8:66097007-66097029 CATTTTACAAATAAGAAAATGGG - Intronic
1042889034 8:73586495-73586517 CACCCTGCAAATAAGGAGATGGG + Intronic
1042973726 8:74440479-74440501 CACTTAGAAAATGAGGAATTAGG - Intronic
1043083982 8:75804095-75804117 CATTTTACAAATAGGGAAATTGG - Intergenic
1043304224 8:78773905-78773927 CTCATTGCAAATATGCAACTGGG + Intronic
1044232451 8:89795003-89795025 CACTTTTCAAATAGGTAAATTGG + Intergenic
1045960411 8:107961442-107961464 CATTTTGCAAATAAGAAACCTGG + Intronic
1046406901 8:113785783-113785805 GACTTTCAAAATAAAGAACTAGG + Intergenic
1046876521 8:119260615-119260637 CACTTGGCACATAAAGAACATGG + Intergenic
1047196378 8:122725763-122725785 CACCTTGAAAATAAGCTACTTGG - Intergenic
1047439432 8:124863731-124863753 CATTTTACGAATAAGGAATTGGG + Intergenic
1047790786 8:128201469-128201491 CATTTTGGAAATAAGGATTTGGG + Intergenic
1048374910 8:133814759-133814781 CACTTTGGAAATCAGAATCTAGG - Intergenic
1048482793 8:134816177-134816199 TACTTTACAGATGAGGAACTAGG + Intergenic
1048927468 8:139283934-139283956 CATTTTGCAAATGAGGAACCCGG + Intergenic
1048933668 8:139337744-139337766 CACTTTAAAAATAAGGACCGTGG + Intergenic
1050747264 9:8891029-8891051 CACTTTAAAAATAAGGATCAAGG + Intronic
1050859301 9:10405154-10405176 AACCTTCCAAAAAAGGAACTGGG + Intronic
1053632253 9:39955738-39955760 TACTTTCCAAATAAAAAACTAGG + Intergenic
1053773507 9:41507792-41507814 TACTTTCCAAATAAAAAACTAGG - Intergenic
1054211635 9:62294960-62294982 TACTTTCCAAATAAAAAACTAGG - Intergenic
1054313350 9:63553882-63553904 TACTTTCCAAATAAAAAACTAGG + Intergenic
1056022051 9:82448268-82448290 CACAGTGCAAACAAGGCACTGGG - Intergenic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1056538323 9:87550660-87550682 TACCTTACAAATAAGGTACTGGG + Intronic
1056572461 9:87828036-87828058 CACCTGGCAAATAAGGAACATGG - Intergenic
1057742261 9:97722093-97722115 TATTTTACAAATGAGGAACTTGG + Intergenic
1058582151 9:106470189-106470211 TACTTTGCAGATAAGGAAATTGG + Intergenic
1059676728 9:116547575-116547597 CACTTCACAGATAAGGAAGTAGG - Intronic
1059731093 9:117058012-117058034 AACTTTACAAATAATCAACTGGG - Intronic
1060146494 9:121257366-121257388 CAGTTTGCAAATGAGAAAATCGG + Intronic
1060325653 9:122611941-122611963 CACTTTATAAATGAGGAAATTGG - Intergenic
1060916530 9:127395156-127395178 TGCTTTTCAAATAAGGAAATAGG + Intergenic
1061197477 9:129115160-129115182 CACATTCCAAATAATCAACTTGG - Intronic
1186404862 X:9293008-9293030 TGCTCTGCAAATTAGGAACTAGG + Intergenic
1186641526 X:11460828-11460850 CACTTTACAAATGAGGAAACAGG - Intronic
1186721893 X:12313382-12313404 CACTTTGCAAAACAGGTAGTGGG - Intronic
1187110212 X:16290665-16290687 GACTTTGCAAATATGGCACTAGG - Intergenic
1187484587 X:19690410-19690432 AACTTTTTAAATAAGGAATTAGG + Intronic
1187562330 X:20414437-20414459 CACTTTGCAGATGAGTAACCTGG - Intergenic
1187900197 X:24021075-24021097 AACTTTGCAAGTAAGAAATTAGG - Intronic
1188244912 X:27828298-27828320 CACTTTGAGAAGAAAGAACTTGG + Intergenic
1188823660 X:34803793-34803815 CCTTTAACAAATAAGGAACTGGG - Intergenic
1188951581 X:36382084-36382106 CACATAGCAAATATGGTACTTGG - Intronic
1189206030 X:39239591-39239613 CACTTTCCACATAAGGAAATTGG + Intergenic
1189899859 X:45695240-45695262 TACTCTGGAAATAAGTAACTAGG - Intergenic
1190067218 X:47249610-47249632 CATTTTGCAGATAAGGAAGCAGG + Intergenic
1192588653 X:72341122-72341144 CACTATGGCAATAAGGAACTGGG - Intronic
1195430248 X:104781261-104781283 CACTTTACAGATGAGGAAATTGG + Intronic
1196141182 X:112265214-112265236 CACTTTACAAATAAGAATCCAGG - Intergenic
1196739520 X:119012312-119012334 CACTTTACAAATAAGGAAACTGG - Intronic
1196866327 X:120074397-120074419 CACTCAGCAAATAAGGAAAAAGG - Intronic
1196876771 X:120161884-120161906 CACTCAGCAAATAAGGAAAAAGG + Intronic
1197014815 X:121611001-121611023 CATTTTACAGATAAGAAACTGGG + Intergenic
1197772282 X:130096910-130096932 CACTTTACAGATAGGGAAATTGG - Intronic
1198732612 X:139748581-139748603 CTTTTTGAAAATAAGGAACCAGG - Intronic
1198805382 X:140489140-140489162 CATTTTACAGATAAGGAAATTGG + Intergenic
1199531795 X:148856372-148856394 CATTTTACAAATGAAGAACTGGG + Intronic
1201235041 Y:11900891-11900913 CATTTTACAAATAAGGAAAAAGG - Intergenic
1201526746 Y:14944414-14944436 CATTTTACAAATGAGGAAATTGG - Intergenic