ID: 967330904

View in Genome Browser
Species Human (GRCh38)
Location 3:188288378-188288400
Sequence GACCTCACGGGACTGGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967330904_967330910 28 Left 967330904 3:188288378-188288400 CCTCACACCAGTCCCGTGAGGTC 0: 1
1: 0
2: 2
3: 27
4: 286
Right 967330910 3:188288429-188288451 GAAATGACTTGTTCCAGATGAGG 0: 1
1: 0
2: 3
3: 23
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967330904 Original CRISPR GACCTCACGGGACTGGTGTG AGG (reversed) Intronic