ID: 967330904 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:188288378-188288400 |
| Sequence | GACCTCACGGGACTGGTGTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 316 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 27, 4: 286} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967330904_967330910 | 28 | Left | 967330904 | 3:188288378-188288400 | CCTCACACCAGTCCCGTGAGGTC | 0: 1 1: 0 2: 2 3: 27 4: 286 |
||
| Right | 967330910 | 3:188288429-188288451 | GAAATGACTTGTTCCAGATGAGG | 0: 1 1: 0 2: 3 3: 23 4: 188 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967330904 | Original CRISPR | GACCTCACGGGACTGGTGTG AGG (reversed) | Intronic | ||