ID: 967331154

View in Genome Browser
Species Human (GRCh38)
Location 3:188290986-188291008
Sequence CTGTAGCATCAGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967331148_967331154 -1 Left 967331148 3:188290964-188290986 CCACCTCTTCCTTGGACTGTTTC 0: 1
1: 0
2: 1
3: 34
4: 329
Right 967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 244
967331150_967331154 -10 Left 967331150 3:188290973-188290995 CCTTGGACTGTTTCTGTAGCATC 0: 1
1: 0
2: 0
3: 23
4: 202
Right 967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 244
967331149_967331154 -4 Left 967331149 3:188290967-188290989 CCTCTTCCTTGGACTGTTTCTGT 0: 1
1: 1
2: 1
3: 34
4: 367
Right 967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967331154 Original CRISPR CTGTAGCATCAGAAGGAGGT GGG Intronic
901414365 1:9106500-9106522 CTGCAGCATAACAAGGAGGTCGG - Intronic
902359946 1:15936950-15936972 GGGTAGCATCAGCAGGAGGCAGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
906276264 1:44518447-44518469 CTTTGGCATCAGGAAGAGGTGGG - Intronic
907418575 1:54331281-54331303 CTGTAGCATCTGGAAGTGGTTGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
912412951 1:109490532-109490554 GAGTAGCATGAAAAGGAGGTGGG + Intronic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
913283726 1:117209229-117209251 CTGGAGGATTAGCAGGAGGTGGG - Intronic
914360418 1:146931054-146931076 TTGTAGCTTGAGAAGGAGCTGGG + Intergenic
914493329 1:148168844-148168866 TTGTAGCTTGAGAAGGAGCTGGG - Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
916683808 1:167126911-167126933 CTGAAACACCAGAAGAAGGTGGG + Exonic
916785338 1:168083047-168083069 GTGTGGCTTCAGAGGGAGGTGGG - Exonic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
918344373 1:183593419-183593441 CTGCAGCATGGGAAGGAGTTCGG - Intronic
919848182 1:201654785-201654807 CTATAGCATCATAGGCAGGTGGG + Intronic
919848605 1:201657220-201657242 CTATAGCATCATAGGCAGGTGGG + Intronic
919921224 1:202167736-202167758 CTACAGCATCAGGAAGAGGTGGG + Intergenic
919921390 1:202168494-202168516 CTACAGCATCAGGAAGAGGTGGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
921377598 1:214490719-214490741 CTGTAGCCTCCGAAGTAGCTGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
922071294 1:222196469-222196491 CTGTTGCATCAGAAGGCTTTGGG - Intergenic
922182271 1:223244599-223244621 CTGTAGCATCAGGGTGGGGTTGG - Intronic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1067334922 10:45353280-45353302 CTGTGCCATCAGAAGTAGGCAGG - Intergenic
1068566113 10:58577327-58577349 CTTTGGCATCAGAATGATGTTGG - Intronic
1069329635 10:67277245-67277267 CAGTTGCATCAGAAGGCAGTGGG - Intronic
1070338131 10:75472946-75472968 CTTTGGCATGAGAAGGAGATTGG + Intronic
1070728865 10:78811142-78811164 CTGAAGCATCAGACAAAGGTAGG + Intergenic
1071572120 10:86703102-86703124 CTGTAGGATGAATAGGAGGTTGG - Intronic
1074075249 10:110117389-110117411 CTGTAGCTTCAGAAAAAGATAGG - Exonic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1077634266 11:3831287-3831309 CTGTAGCCTGGGAGGGAGGTGGG - Intronic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1079626691 11:22625278-22625300 CTGGAGCGTCTGCAGGAGGTGGG - Exonic
1079844304 11:25445626-25445648 CTGAAGCCTGAGAAGGAGCTCGG + Intergenic
1079889159 11:26028753-26028775 CTTTAGCATCTGAAAGAGGCAGG - Intergenic
1080583288 11:33660606-33660628 ATGTAGCAACAGAGGCAGGTGGG - Intronic
1080798858 11:35590637-35590659 CTATAGCATCAGGAGGAGGGAGG - Intergenic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083007913 11:59366038-59366060 CTGTAGCATAAGAAAGAAGGAGG + Intergenic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1087855429 11:103086935-103086957 CTTTAGAATCAGAAGGACCTGGG + Intronic
1088659743 11:112033837-112033859 CTTTAGCCTCACAAGTAGGTAGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1100176302 12:92034883-92034905 CTGTAGTATCTGAACAAGGTGGG - Intronic
1101346756 12:103892950-103892972 CTGTGGCTTCAGGAGAAGGTAGG - Intergenic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1101869995 12:108558301-108558323 CTGTGGGATCAGGATGAGGTGGG + Intronic
1105251135 13:18699112-18699134 GTGTAGCATAACAAGGGGGTGGG - Intergenic
1108106225 13:47013689-47013711 CTGTATCAGCTGAAGGAGATGGG + Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108735621 13:53280788-53280810 CTGTAGCATCAGAGTGGGGGAGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112924788 13:104660903-104660925 CTGTAGCCTGGGAAGGAGCTGGG + Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1119896073 14:78220902-78220924 CTGTGGCATCTGAATGAGGAAGG + Intergenic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1122271704 14:100571183-100571205 CTGGACCACCAGAAAGAGGTAGG - Intronic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124214444 15:27794996-27795018 CTATAGCATGGGAAGCAGGTGGG + Intronic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1127771260 15:62232642-62232664 TTGTAGCAAGAGTAGGAGGTGGG + Intergenic
1127967395 15:63932608-63932630 CAGTAGCTTGAGAAGGAGGAAGG + Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1129342870 15:74897558-74897580 CTGTACCATCAGGAGGATGCTGG - Exonic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136350194 16:29701617-29701639 CTGTAGCATCGGATGGTGGGTGG - Intergenic
1136394631 16:29986394-29986416 CTGCAGCACCAGACGGAGCTGGG + Exonic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1141663373 16:85453498-85453520 CTCTTTCATCAGGAGGAGGTCGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144684150 17:17215180-17215202 CTGTAGCTGCAGACCGAGGTGGG - Exonic
1148241997 17:46005729-46005751 CTGGAGCTGCGGAAGGAGGTGGG - Intronic
1148745326 17:49914787-49914809 CTGTAGCATCAACAAGAAGTGGG - Intergenic
1150939850 17:69680871-69680893 CAGTAGTATCAGAAGGCTGTTGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1156033067 18:32735575-32735597 CTGAAGGATAAGAAGGAGTTAGG - Intronic
1156486343 18:37468357-37468379 CTGGAGCTCCAGAAGAAGGTTGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159374618 18:67577125-67577147 ATGTAACATCAGAGGGATGTGGG + Intergenic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1163557481 19:18000991-18001013 CTGTTGAATCAGAAGCAGGCAGG - Intergenic
1165141814 19:33704289-33704311 CTGTAGCCTTTGGAGGAGGTGGG - Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165545141 19:36528808-36528830 CTACAGGATCAGGAGGAGGTTGG + Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1167144603 19:47674139-47674161 CTGAAGGATCACAGGGAGGTAGG + Intronic
1168082943 19:54023775-54023797 CTGCAGCTTGAGAAGGAAGTGGG - Intergenic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928588781 2:32791757-32791779 CTGTAGCCTCACAAGTAGCTGGG - Intronic
929326251 2:40614791-40614813 TTGTAGCATGAGACTGAGGTGGG + Intergenic
929575435 2:43049061-43049083 CTGTAGCCTCCCAAGGTGGTTGG - Intergenic
929744393 2:44640999-44641021 CTGTAACATAAAAAGGAGGGAGG - Intronic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930190093 2:48449301-48449323 CAGTAGCCTCAGAAGAAGGAAGG + Intronic
931258910 2:60599767-60599789 GTGCAGCATCAGGAGGAAGTTGG + Intergenic
931671113 2:64648707-64648729 CTGGAGCTTTAGAAGGAGGCAGG + Intronic
931943247 2:67276618-67276640 CTGTAGCATCAGGACCAAGTGGG + Intergenic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
942499821 2:176577883-176577905 CTGTAGTATCAGGGGGAGGAGGG - Intergenic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944279935 2:197884446-197884468 ACGTAGCAACAGAAGGAGGCTGG + Intronic
945457182 2:210063761-210063783 CTGTAAAATCAAAAGCAGGTTGG - Intronic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
945862904 2:215144233-215144255 CTGCAGCATCAGAAGGTCATTGG + Intergenic
946939763 2:224758534-224758556 TTGTAGCAGCAGTAGCAGGTGGG + Intergenic
948217379 2:236241725-236241747 CTGTATCATCACAAAGAGGGTGG - Intronic
1169533494 20:6511212-6511234 CTTTGGTATCAGAATGAGGTTGG + Intergenic
1169653707 20:7898126-7898148 CTGTTGCATAAGAAGTAGGGTGG + Intronic
1170577123 20:17672635-17672657 TTGCAGGACCAGAAGGAGGTAGG - Intronic
1172447674 20:35001678-35001700 CTGTTCCATGAGAAGGAGCTAGG - Intronic
1173225228 20:41158621-41158643 CAATAGCATCAGAAAGATGTTGG - Intronic
1174162179 20:48559310-48559332 CTGGAGCATCAGGAGGCTGTGGG + Intergenic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1177183203 21:17765798-17765820 CTGTAGCATCAGCATCAGCTGGG + Intergenic
1179344487 21:40544101-40544123 CTGCAGCATCAGCAGGAGTCAGG + Intronic
1179399648 21:41071700-41071722 CTGTAGCTTAAGAGGGAGGCAGG - Intergenic
1183065699 22:35361275-35361297 CTTTGGCATCAGACGGAGCTGGG - Intergenic
1183981270 22:41541928-41541950 GTGGAGCATCAGAAGGTGATGGG - Intronic
1185305492 22:50113112-50113134 CTGTAGCATCAGTAGAAGAAGGG + Intronic
950969921 3:17176082-17176104 CTGTAGAATCAGACAGAGCTGGG + Intronic
951678626 3:25271109-25271131 TTTTAGCATCAAAATGAGGTTGG + Intronic
955545898 3:60029820-60029842 TTGTAGCACCAGAAAGAGGTTGG + Intronic
957207649 3:77218262-77218284 CATTAGTATGAGAAGGAGGTTGG - Intronic
957669986 3:83288922-83288944 CTTTAGTATCAGAATGATGTTGG + Intergenic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
960466505 3:118002434-118002456 CTGTAACATCAGACAGATGTGGG + Intergenic
961440026 3:126947249-126947271 CTGCAGCATCAACATGAGGTGGG - Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
970991297 4:22216248-22216270 CTCTAGATTCTGAAGGAGGTGGG + Intergenic
971449607 4:26787717-26787739 CTGAAGGTTCAGAAGGAAGTAGG + Intergenic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974985852 4:69025572-69025594 ATGCAGCATCAGAAAAAGGTGGG + Intronic
975519409 4:75283287-75283309 CTGTAGCATTAGAAGGATTTAGG + Intergenic
975568173 4:75782836-75782858 CTGTAGCATTAGATGTAGATTGG - Exonic
977035695 4:91950206-91950228 CTGTAGCCCCAGCACGAGGTAGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978901921 4:113961399-113961421 ATGTTACATCAGATGGAGGTTGG + Intronic
979197681 4:117940348-117940370 TTGGAGTATCAGAAGGAGATGGG - Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980262615 4:130471815-130471837 CTCTAGTAGCAGAAGGTGGTCGG - Intergenic
981089897 4:140721628-140721650 CTGTGGAATCTGAAGTAGGTAGG - Intronic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
985639183 5:1055599-1055621 CTGTAGGGTCAGGAGAAGGTGGG - Intronic
985849541 5:2378645-2378667 CATTACCCTCAGAAGGAGGTGGG - Intergenic
987377665 5:17251545-17251567 GTCTAGCAGCAGGAGGAGGTAGG + Intronic
995140049 5:108725826-108725848 CTGTGGCATCAGAAAGAGCAGGG + Intergenic
1001180369 5:169514466-169514488 GTGTAGCATCAGAAGCATCTTGG + Intergenic
1001862276 5:175067682-175067704 CTGTAGCATATCAAGCAGGTTGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003905385 6:10694620-10694642 CCGTGACATCAGGAGGAGGTGGG - Intronic
1004428120 6:15519875-15519897 ATGTGGCATCAGGAGGAGCTGGG + Intronic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1008035766 6:46743528-46743550 CTTTAGAATTGGAAGGAGGTAGG + Intergenic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1010550603 6:77217824-77217846 CTTTAGCATGAGGAGAAGGTAGG - Intergenic
1014049848 6:116939014-116939036 CTGAAGCATGAGTAGGAAGTGGG + Intergenic
1017690166 6:156956155-156956177 CTCTAGCAGGGGAAGGAGGTGGG + Intronic
1018147167 6:160902270-160902292 CTTTAGCATCAGAATGATGCTGG + Intergenic
1018358801 6:163045027-163045049 CTGGAGTATCTCAAGGAGGTAGG + Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1020588967 7:10109799-10109821 CTGTAGCATCATATGGAGAAAGG - Intergenic
1020592818 7:10164664-10164686 CTGAAGAATCTGAAGTAGGTGGG - Intergenic
1022417791 7:30192767-30192789 CTGAAGGATCAGCAGGAGCTGGG + Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023337048 7:39181174-39181196 TGATGGCATCAGAAGGAGGTTGG + Intronic
1023501496 7:40854818-40854840 CTTTAGCTTCAAAAGTAGGTAGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026807553 7:73437452-73437474 GTGCAGCATTACAAGGAGGTAGG - Intergenic
1029307633 7:99632115-99632137 CTTAAGCTTCAGAAGGAGCTGGG + Exonic
1030434697 7:109502015-109502037 CTCTAGCAGGAGAAGGAGATAGG + Intergenic
1031368608 7:120935825-120935847 ATGTAGCAGAAGCAGGAGGTAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1036553100 8:9832543-9832565 CTGTAGCCTCAGCAGGTGGGAGG - Intergenic
1036667019 8:10752961-10752983 TGGAAGCATCAGAAGGAAGTGGG - Intronic
1036727098 8:11230117-11230139 CTGGTGCTTCAGAAGGAAGTGGG + Intergenic
1037297900 8:17420625-17420647 CTCAAACATCAGAAGGAAGTGGG + Intergenic
1037922708 8:22818741-22818763 CAGTAGCATGGGAAGGATGTTGG + Intronic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1038311272 8:26448287-26448309 CTGTAAGATCTGAAGGGGGTGGG + Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039685768 8:39800642-39800664 TTGGAGTATCAGAAGGAGATGGG - Intronic
1040377776 8:46843052-46843074 CTGTAGCATCATCAGCAGCTGGG - Intergenic
1040859916 8:51988554-51988576 TTTTAGCATCAAAAAGAGGTGGG - Intergenic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1045006297 8:97919535-97919557 CGATAACATCAGAAAGAGGTGGG - Intronic
1050423380 9:5490076-5490098 CTCTAGCAGCAGAAGCTGGTGGG + Intergenic
1050937827 9:11421176-11421198 CACTAGCAAGAGAAGGAGGTAGG + Intergenic
1054876772 9:70105911-70105933 CTGTAGCATGTAAAGGAGGTAGG - Intronic
1055923686 9:81488703-81488725 CTTTGGCCTCAGAAGCAGGTAGG - Intergenic
1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG + Intergenic
1057236446 9:93365673-93365695 CAGTAGCATGTCAAGGAGGTGGG - Intergenic
1058175114 9:101726424-101726446 CTGTACCACCAGAAGGTGTTTGG - Intronic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1061503965 9:131020188-131020210 CTCGAGCATCAGAACCAGGTGGG + Intronic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1188312700 X:28637166-28637188 CTGTGGCACATGAAGGAGGTGGG - Intronic
1189554366 X:42126788-42126810 CTGTAGCATCAGAAGGATTCTGG + Intergenic
1189589632 X:42497248-42497270 CTGTAGCATCTTAGGGAGGGTGG + Intergenic
1190097943 X:47497470-47497492 CTGAACTTTCAGAAGGAGGTGGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195832892 X:109079063-109079085 CTGTATCTTCATAAGGATGTGGG - Intergenic
1196188816 X:112773534-112773556 CTGCAGAATAAGATGGAGGTGGG + Intergenic
1196551125 X:117026861-117026883 CTGTAGCACCAGAGTGTGGTTGG + Intergenic
1198018508 X:132635472-132635494 CTGTAGCATGTGGAGGAGCTTGG - Intronic
1198040621 X:132848018-132848040 CTGGTGCATCAGATGGGGGTGGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200910348 Y:8526337-8526359 CTGTAGGGTGAGAAGCAGGTAGG + Intergenic
1200932193 Y:8707102-8707124 CTGTAGGATGCGAAGGAGGCAGG - Intergenic
1200984765 Y:9293195-9293217 CTGTAGGATGAGAAGCAGGCAGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1202125676 Y:21566992-21567014 CTGTAGGATGAGAAGCAGGCAGG + Intergenic
1202153332 Y:21862400-21862422 CTGTAGGATGAGAAGCAGGCAGG - Intergenic