ID: 967336721

View in Genome Browser
Species Human (GRCh38)
Location 3:188352331-188352353
Sequence CACCTTTGGCAGCTTGTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967336721 Original CRISPR CACCTTTGGCAGCTTGTGAG CGG Intronic
900086210 1:898839-898861 CACCACTGGGAGCTTGTGAGCGG + Intergenic
904567984 1:31439443-31439465 CACCTGTGGCAGCAAGTCAGTGG - Intergenic
907276496 1:53319709-53319731 GACATATGGCAGCTTGTGAGAGG + Intronic
908749416 1:67405670-67405692 ACCCTTTGGCAGCGTATGAGAGG - Intergenic
913177718 1:116290298-116290320 CTCCATTGTCAGCTGGTGAGAGG - Intergenic
919021960 1:192117242-192117264 CACATTTGGCAGCATTTAAGTGG - Intergenic
922866160 1:228863141-228863163 CACCTTTGCCTGCCTGTGAAGGG + Intergenic
923114901 1:230926300-230926322 GACCCTTGGAAGCTTGTGACTGG - Intronic
924510196 1:244723752-244723774 CAGTTCTTGCAGCTTGTGAGCGG - Intergenic
1062949288 10:1485442-1485464 TACCTATGGCAGCATGTGGGGGG + Intronic
1063374698 10:5547211-5547233 CTCCTTTGGCAGCCAGAGAGGGG - Intergenic
1066501602 10:36000415-36000437 CACCTGTGGAAGCTTGGGTGTGG + Intergenic
1069469365 10:68673583-68673605 CACCTTTATCAGCTCGTGGGTGG + Intronic
1074462282 10:113648718-113648740 CACCTTCAGCAGCTGTTGAGAGG - Intronic
1081136929 11:39450368-39450390 AATCTTTGGCAGCTTCTGTGTGG - Intergenic
1081771538 11:45653140-45653162 CTCCTTTGGGAGCGGGTGAGTGG + Intronic
1084003676 11:66312446-66312468 CACTTTTGTGAGCTTGAGAGGGG + Intergenic
1087091969 11:94282892-94282914 CTCCCTTGGCTTCTTGTGAGAGG - Intergenic
1087129805 11:94658896-94658918 CAACATTGCCAGCTTCTGAGAGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089281340 11:117376859-117376881 CTCCTTTGGCAGTAGGTGAGTGG + Intronic
1090420659 11:126572939-126572961 CTCATTCGGCAGCATGTGAGGGG - Intronic
1090877879 11:130807062-130807084 CACATTTCACAGCTTGTCAGTGG + Intergenic
1091691758 12:2601946-2601968 CTCCTTTGGCATCCAGTGAGTGG + Exonic
1098354647 12:69600659-69600681 CACCCTTGGTAGCTTATGGGGGG - Intronic
1098683621 12:73390874-73390896 CACCTTTGGCATTTTGCTAGTGG + Intergenic
1099930217 12:89065648-89065670 CACCTTTGGGATATTGTGAATGG - Intergenic
1110408410 13:75176559-75176581 CACATTTTGCAGCTATTGAGAGG - Intergenic
1110593210 13:77288158-77288180 TACCTTTGGAAGCTTGATAGGGG + Exonic
1114444663 14:22779275-22779297 TGCCTTTGGCAGATTGTGATAGG - Intronic
1122345490 14:101056157-101056179 CAGCCTGGGCAGCTTGGGAGTGG - Intergenic
1125925733 15:43561390-43561412 CACTTTTTTCAGCTGGTGAGTGG + Intronic
1125938877 15:43660941-43660963 CACTTTTTTCAGCTGGTGAGTGG + Intronic
1129924726 15:79353955-79353977 CACATTTGGAAGCTTGTGTTTGG + Intronic
1130132304 15:81154226-81154248 CACCTTTGAGGGCTTCTGAGAGG + Intergenic
1131107563 15:89745205-89745227 CTCCTTTCCCAGCGTGTGAGGGG + Intergenic
1133480414 16:6165134-6165156 CAGCTTTGGCAGTTTTTAAGTGG + Intronic
1138250542 16:55498599-55498621 CACCTTTGGCAACATCTCAGAGG - Intronic
1139049096 16:63101274-63101296 CAGCTTTGCCAGCTTTTAAGAGG - Intergenic
1139963285 16:70730180-70730202 AGACTGTGGCAGCTTGTGAGGGG - Intronic
1141207031 16:81940443-81940465 GACCTTTGGCATCTTGGGGGGGG + Intronic
1142286050 16:89171980-89172002 CGCCTTTGGGGGCCTGTGAGCGG + Intronic
1146785568 17:35717841-35717863 CACCTTTGGAAGCGTATAAGGGG + Intronic
1148212472 17:45816842-45816864 CCCCATTGGCAGCTGGTAAGGGG + Intronic
1152128621 17:78462361-78462383 CACCATTGACACCCTGTGAGGGG - Intronic
1152943673 17:83186385-83186407 CCCCTCTGGCAGCTCGTGAGGGG + Intergenic
1155214346 18:23629915-23629937 CACCTTGGGCAGCTAGGAAGAGG + Exonic
1158326068 18:56315035-56315057 CACATTTGGCAATGTGTGAGGGG - Intergenic
1166585946 19:43949175-43949197 CAGCTGTGGCAGCTTGCTAGTGG + Intergenic
1168715244 19:58523168-58523190 CTCCCTTGGCTGCTTGAGAGAGG - Intronic
927966338 2:27271930-27271952 CACCTTTCGCATCTTGACAGAGG - Intronic
932579262 2:72982998-72983020 CACCTGTGGCAGCTTGTCCTGGG - Intronic
932857792 2:75255698-75255720 CAGATTTGGCATCTGGTGAGGGG - Intergenic
933115779 2:78469675-78469697 CACCTCTGGCTGCATGGGAGAGG - Intergenic
935270399 2:101429614-101429636 CACCTCTGGCATCTTGAGAATGG - Intronic
936152965 2:110031726-110031748 CACCTTTGGCCACCTGTGTGGGG - Intergenic
936191715 2:110339686-110339708 CACCTTTGGCCACCTGTGTGGGG + Intergenic
946326958 2:218989575-218989597 CACCTTTGCCACCTTGTGGGTGG - Intergenic
948063498 2:235059484-235059506 CACCTCTGGCAGTTTGAGAAAGG + Intergenic
948646081 2:239406015-239406037 CAACTTTGGTAGCTTTTGACTGG - Intergenic
948685996 2:239670092-239670114 CACCTGTGGCAGCTTTGCAGCGG - Intergenic
948851590 2:240710819-240710841 CCCCTTTGGCAGGTGGTAAGTGG - Intergenic
1170174711 20:13455938-13455960 CACTTTTGGCACCTGGCGAGTGG - Intronic
1172609258 20:36237270-36237292 CACCCATGTCAGCTTCTGAGTGG - Intronic
1173375120 20:42476196-42476218 TGCCTTTGGAAGCTTGTGTGGGG + Intronic
1176243793 20:64087835-64087857 CACCCTTGGCAGGTTGGGGGAGG + Intronic
1178069363 21:28945843-28945865 CCCCTTTGGCAGAGAGTGAGTGG - Exonic
1178345252 21:31820370-31820392 CACCTGTGGCAGCCTTTTAGGGG + Intergenic
1181963942 22:26643336-26643358 GACCTTTAGCAGCTTCTGGGTGG + Intergenic
1183099481 22:35575129-35575151 CTCCTTCGGCATCTTGTCAGAGG - Intergenic
1183198055 22:36366996-36367018 CCCCTTTGAGAACTTGTGAGAGG + Intronic
1183469824 22:37999315-37999337 CACCTTTGGCCGCCTGCGTGTGG + Intronic
1184251053 22:43260612-43260634 CAGCTTTGGCTGCTTCTGTGAGG - Intronic
949283854 3:2378341-2378363 AACCCATAGCAGCTTGTGAGAGG + Intronic
950012756 3:9734655-9734677 CACCTCTGGCAGCTTGGGAGTGG - Exonic
951348969 3:21581822-21581844 CACCTTGGGAAGCTTGTTAAAGG + Intronic
953020525 3:39110211-39110233 CTCCTTTGGCAGCCCTTGAGGGG - Intronic
954659007 3:52216542-52216564 CAACTTTGTCAGCCTGTGTGAGG - Intergenic
954797996 3:53171320-53171342 CACCTCTGCCAGCTTGTGTGGGG - Intronic
955138607 3:56246325-56246347 CACTGCTGGCAGCTTGTGGGTGG - Intronic
955738563 3:62065458-62065480 CACCTTTGGCAGTCTTTCAGGGG + Intronic
958580295 3:96009584-96009606 AACAGTTGGCAGCTTGTGATTGG + Intergenic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
966787889 3:183636631-183636653 CGCCTGCGGCAGCTTGTGGGCGG + Intronic
966890167 3:184401557-184401579 TACCTTTGGCAGCCTGTCAAAGG + Intronic
967336721 3:188352331-188352353 CACCTTTGGCAGCTTGTGAGCGG + Intronic
967845232 3:194037649-194037671 CACCTTTAACAGCCTGTGGGTGG + Intergenic
968493372 4:902313-902335 AAACTTTGGCAGCCTGGGAGCGG + Intronic
968602568 4:1517270-1517292 CACCTGTGGCTGCTGGTGGGCGG - Intergenic
979994818 4:127418296-127418318 CAATTTTGGCAGTTTCTGAGGGG - Intergenic
981696731 4:147566455-147566477 CACTTTAGGGAGCTTGTCAGGGG - Intergenic
982337572 4:154257541-154257563 CACCTTTGGCGGGATGGGAGTGG + Intronic
982505783 4:156216069-156216091 CACAGTTGGCAGCATGTGACTGG + Intergenic
983211838 4:164966522-164966544 CACTTTTGCCAGCTTTTTAGAGG - Intronic
983372980 4:166887192-166887214 TTCCTTTTGCAGCTTGTGATTGG + Intronic
985054615 4:186025579-186025601 CACCCTTGGCAGAGTGTGAGAGG + Intergenic
985949340 5:3211305-3211327 CACATATGGCAGCTTGTTAGGGG - Intergenic
986479617 5:8173345-8173367 CATCTTTGTCAGCCTGTGAGAGG - Intergenic
986659237 5:10044251-10044273 CACCTCTGACAGCTTCTCAGGGG - Intergenic
987784417 5:22480692-22480714 CACCTTTGGAAACTTGTTTGAGG - Intronic
987978791 5:25052940-25052962 ATCCTTTGGCAGCCTGTGATTGG - Intergenic
989049127 5:37301296-37301318 CATCTTTGGCAGCTTGTCACTGG - Intronic
998488291 5:142523137-142523159 CAGATTTGGCAGTGTGTGAGGGG - Intergenic
1000248450 5:159469954-159469976 CAGCTTTGGCTGCATGTCAGAGG - Intergenic
1006641118 6:35490321-35490343 GACCGCTGGCAGCTGGTGAGGGG + Intronic
1007089371 6:39172639-39172661 GACGTTTGGCAACTTGTGGGAGG - Intergenic
1008909010 6:56713201-56713223 GACCCTGGGCAGCTGGTGAGTGG + Intronic
1009318644 6:62256693-62256715 CCCCTCTGGCAGTTTTTGAGAGG - Intronic
1012058059 6:94441176-94441198 CACCTTTTGCAGAAGGTGAGGGG + Intergenic
1012417161 6:99023636-99023658 AACGTTTGGCAGCATGTGATTGG - Intergenic
1014946467 6:127504522-127504544 CACCCTTGGCTGCCTGTGAATGG - Intronic
1022308532 7:29173608-29173630 CACCTTTGGCAGAGTATGGGAGG + Intronic
1024074542 7:45811852-45811874 GACCTTTGTCAGCGTGGGAGGGG - Intergenic
1024648550 7:51387461-51387483 GACCTCTGTCAGCTTGGGAGGGG + Intergenic
1025240389 7:57266907-57266929 CACCTTTCACACCATGTGAGGGG - Intergenic
1028654106 7:93183341-93183363 CACCTTCAGAAGCATGTGAGTGG - Intergenic
1029888898 7:103905778-103905800 CAAATTTGGTAGCTTGTTAGAGG + Intronic
1033468929 7:141625712-141625734 CACCTTTGGCAGGGCATGAGAGG - Intronic
1035332321 7:158104462-158104484 CTCCTTTTTCATCTTGTGAGGGG - Intronic
1039786368 8:40837966-40837988 CTGCTTTGCCATCTTGTGAGGGG + Intronic
1042065682 8:64872993-64873015 CACCTTTGGCAAAATCTGAGTGG + Intergenic
1044377030 8:91487347-91487369 CATCTTTGGCAAATAGTGAGTGG - Intergenic
1049480743 8:142821289-142821311 CCCCTTTGCCAGGTTGGGAGAGG + Intergenic
1053589677 9:39499267-39499289 TACCTTTGGCAACTTGAAAGAGG - Intergenic
1054576619 9:66866040-66866062 TACCTTTGGCAACTTGAAAGAGG + Intronic
1057420421 9:94907749-94907771 CACCTTGGTCAGCTGTTGAGAGG - Intronic
1059565896 9:115382687-115382709 CAGCTTTGCCTGCTTGTGATAGG + Intronic
1059922706 9:119176606-119176628 CATCTTAGGCAGCTGGTGAGAGG + Intronic
1060811903 9:126614888-126614910 CACCTTGGCGAGCTTGGGAGAGG + Intronic
1186437159 X:9552506-9552528 CACCTGTAGAAGATTGTGAGAGG - Intronic
1186549548 X:10488412-10488434 CACCTCCAGCAGTTTGTGAGAGG + Intronic
1188763514 X:34060727-34060749 CACCTCTGGCAGCTTTTAACTGG - Intergenic
1195069831 X:101268032-101268054 CAGCTTTGGCATCTGGTGAGGGG - Intergenic
1196123479 X:112075308-112075330 AACATTGCGCAGCTTGTGAGTGG - Intronic
1197001597 X:121446288-121446310 CAACTTTGACAGCTTTTGAAAGG - Intergenic