ID: 967341887

View in Genome Browser
Species Human (GRCh38)
Location 3:188407672-188407694
Sequence AGCCCTGAAGTCACTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967341887_967341895 20 Left 967341887 3:188407672-188407694 CCTTCTTTAGTGACTTCAGGGCT 0: 1
1: 0
2: 1
3: 10
4: 142
Right 967341895 3:188407715-188407737 GAATCTCTCTTCATAGGGACAGG 0: 1
1: 0
2: 2
3: 4
4: 89
967341887_967341894 15 Left 967341887 3:188407672-188407694 CCTTCTTTAGTGACTTCAGGGCT 0: 1
1: 0
2: 1
3: 10
4: 142
Right 967341894 3:188407710-188407732 GAAGAGAATCTCTCTTCATAGGG 0: 1
1: 0
2: 1
3: 14
4: 162
967341887_967341896 23 Left 967341887 3:188407672-188407694 CCTTCTTTAGTGACTTCAGGGCT 0: 1
1: 0
2: 1
3: 10
4: 142
Right 967341896 3:188407718-188407740 TCTCTCTTCATAGGGACAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 172
967341887_967341893 14 Left 967341887 3:188407672-188407694 CCTTCTTTAGTGACTTCAGGGCT 0: 1
1: 0
2: 1
3: 10
4: 142
Right 967341893 3:188407709-188407731 GGAAGAGAATCTCTCTTCATAGG 0: 1
1: 0
2: 2
3: 10
4: 150
967341887_967341892 -7 Left 967341887 3:188407672-188407694 CCTTCTTTAGTGACTTCAGGGCT 0: 1
1: 0
2: 1
3: 10
4: 142
Right 967341892 3:188407688-188407710 CAGGGCTTGGGAATGGGATCTGG 0: 1
1: 0
2: 2
3: 43
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967341887 Original CRISPR AGCCCTGAAGTCACTAAAGA AGG (reversed) Intronic
901363353 1:8723383-8723405 ACCCCAGAAGTTACTCAAGAGGG + Intronic
901934174 1:12616667-12616689 AGCTCTGAAGACACGAGAGAGGG - Intronic
904850500 1:33455609-33455631 AGCACTGAAGTCCCAGAAGATGG - Intergenic
907661788 1:56400020-56400042 AAGCCTGAAGTTGCTAAAGAAGG + Intergenic
911125237 1:94335148-94335170 AGCTCTGAAGTCAGGAATGAAGG - Intergenic
912087499 1:106027820-106027842 AGCACTAAAGTCATGAAAGACGG + Intergenic
912211524 1:107562303-107562325 CTCTCTGAAGGCACTAAAGAAGG - Intergenic
913563406 1:120046463-120046485 GGCCATGAAGCAACTAAAGATGG - Intronic
913634717 1:120747114-120747136 GGCCATGAAGCAACTAAAGATGG + Intergenic
914284000 1:146205827-146205849 GGCCATGAAGCAACTAAAGATGG - Intronic
914545031 1:148656566-148656588 GGCCATGAAGCAACTAAAGATGG - Intronic
914621536 1:149414122-149414144 GGCCATGAAGCAACTAAAGATGG + Intergenic
918795588 1:188890700-188890722 AATCATGTAGTCACTAAAGAAGG + Intergenic
920104442 1:203541402-203541424 AGCCCTTTAGTCTCTAAAGTGGG + Intergenic
920973965 1:210768330-210768352 TGGCCTGAAGTCACTAAGTAGGG + Intronic
922609416 1:226913471-226913493 AGCTCTGAAGTCACAACACAAGG + Intronic
924077314 1:240353827-240353849 TGCCCTGGAATCACCAAAGAAGG + Intronic
1063513605 10:6671880-6671902 ATCCCTGAAGACACTCGAGATGG + Intergenic
1070818517 10:79340712-79340734 AGCCCTCAACTCTCTAGAGATGG + Intergenic
1073348250 10:102800681-102800703 AGCCATGACCTCAATAAAGAGGG - Intronic
1079479520 11:20864869-20864891 AGCTCTGAAGTCAGTAAACAGGG - Intronic
1080346165 11:31328165-31328187 AGCCCTGAAGGCACTTTGGATGG - Exonic
1080808957 11:35683127-35683149 AGACCTGAAGTGCCTAAAAAAGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1085980416 11:81717956-81717978 AGCCCTGAATTCAAATAAGAGGG + Intergenic
1086266726 11:85007819-85007841 ATCAGTGAAGTCACAAAAGAGGG - Intronic
1086893632 11:92287498-92287520 AGCTCTAAAGTAACTAAACATGG - Intergenic
1089366113 11:117922026-117922048 GGCCGTGAAGTGCCTAAAGAAGG - Intronic
1091693930 12:2615664-2615686 AGCTCTGAGGTCACCAAGGAGGG + Intronic
1092914503 12:13177869-13177891 AGGCATGAAGCCACCAAAGAAGG + Intergenic
1093170510 12:15854334-15854356 AGTCCTGAAGGAAATAAAGAAGG - Intronic
1096037317 12:48483778-48483800 ATCCATGAAGTCAGAAAAGAAGG + Intronic
1102918268 12:116771961-116771983 AGCCCTGAAGGAACTCAGGAGGG - Intronic
1103574427 12:121866595-121866617 AACCCTGAAGTCACTAAGCTTGG - Intergenic
1105657644 13:22457995-22458017 GGCTATGGAGTCACTAAAGAGGG - Intergenic
1107389698 13:39951389-39951411 AGCCCTGGAGGCACAAAATATGG - Intergenic
1107437286 13:40391221-40391243 AGTCCTCAAGTCATAAAAGAAGG + Intergenic
1107711321 13:43153158-43153180 CCCCCTGAAGTCCCTAAAGAAGG + Intergenic
1108431709 13:50360159-50360181 AGCCTTGAAGGCACCAAATAGGG + Intronic
1114883187 14:26812552-26812574 GGCCATGCAGTCACTAAACATGG + Intergenic
1116469572 14:45271347-45271369 ACCCTTGAAGCCACTAAAAAAGG - Intergenic
1117902071 14:60544595-60544617 AACCTGGAAGACACTAAAGAGGG - Intergenic
1119736169 14:76983995-76984017 CGCCATGAAGTCACTGAAGAGGG + Intergenic
1122763814 14:104050669-104050691 AGCCTTGGGGTCTCTAAAGAGGG - Intronic
1126668698 15:51096228-51096250 AGCCCACACTTCACTAAAGACGG - Intronic
1127123489 15:55790840-55790862 AACCCAGAAGGCACTAAACATGG + Intergenic
1127393146 15:58522745-58522767 AGCCCCGACATCAATAAAGATGG - Intronic
1128669225 15:69561819-69561841 AGCCCTGATGTAATTAAAAATGG + Intergenic
1132282082 15:100627913-100627935 AGCCCTTAAGTCACTCAAGCCGG - Intronic
1136628287 16:31474803-31474825 AGCCCAGCTCTCACTAAAGATGG - Intronic
1137854113 16:51776425-51776447 AGCCCAGAAGAAAGTAAAGAAGG - Intergenic
1138066312 16:53945035-53945057 AGTCCTATAGTCACTAATGATGG - Intronic
1142157024 16:88537312-88537334 AGACCTGAAGTCACCCCAGAGGG + Intergenic
1143356795 17:6335632-6335654 CACCCTGATGTCACGAAAGATGG - Intergenic
1148842633 17:50508671-50508693 CACCATGAAGTCTCTAAAGAAGG + Exonic
1149983488 17:61330095-61330117 AGCCTTCAATTCACTGAAGATGG + Intronic
1151277699 17:73048195-73048217 AGCACTGAAGACTCTAAGGAGGG - Intronic
1151423716 17:74015982-74016004 AGAGCTGAAGTCACTGGAGATGG + Intergenic
1153272747 18:3339431-3339453 AGCCCTGAAGAGAGTAAATAAGG + Intergenic
1154294871 18:13138961-13138983 AGACAGGAAGTCACCAAAGAGGG + Intergenic
1155164696 18:23222873-23222895 AAGCCTGAAGTGACAAAAGAGGG + Intronic
1160619755 18:80162577-80162599 ATCCCTGAAGTCACTGAGTAAGG - Exonic
1162614222 19:11784287-11784309 AGCCTGGAAGTCACTTCAGATGG + Intergenic
1163371361 19:16903018-16903040 AGCCTTGAAATCACTGAAGCGGG + Intronic
1164807449 19:31127880-31127902 AGCCCTTCAGTCACCAGAGATGG - Intergenic
1168494391 19:56837779-56837801 AGCCCTGCTGTCACTCAAGATGG + Intronic
928818773 2:35334498-35334520 TTCCCTGAAGTTACTAAAAATGG + Intergenic
929142634 2:38679622-38679644 AGCTCTGGGATCACTAAAGAAGG - Intronic
929580438 2:43078838-43078860 AGCCCTGAAGCTCCTAAGGAGGG + Intergenic
930869830 2:56159499-56159521 AGACCAGAATTCATTAAAGAGGG - Intergenic
932075987 2:68663348-68663370 TGCCCTGAGGTCATTAAAAAGGG - Intergenic
932451329 2:71812549-71812571 AGGCCTGAACTCACTATAAAAGG - Intergenic
938767477 2:134469890-134469912 AGCCGTGCAGTCAGGAAAGAAGG - Intronic
940440641 2:153712099-153712121 ACCCTTGAAGTTTCTAAAGAAGG - Intergenic
942699480 2:178688281-178688303 AGCCATGTGGTCACTACAGATGG + Intronic
943162533 2:184272388-184272410 TGCCCTGCTGTCACTAAGGATGG + Intergenic
1170744546 20:19087536-19087558 AGCAGAGAAGTCTCTAAAGAAGG + Intergenic
1171862828 20:30417152-30417174 AGCTCTGAAATCATCAAAGAGGG - Intergenic
1173712908 20:45176163-45176185 ACCCCTGAAGACACAAAAGAAGG + Intronic
1175982553 20:62746391-62746413 GGCCCTGAAGTCACTGCAGGTGG + Intronic
1176962205 21:15171952-15171974 AACCGTAAAGTCACTTAAGATGG - Intergenic
1178378035 21:32084410-32084432 AGCCCTGAAGTCTTTCTAGAAGG + Intergenic
1182256428 22:29042368-29042390 ATCCCTGAAGTCACCTAAGTTGG + Intronic
1184738042 22:46410576-46410598 CGCCCTGACGTCACAGAAGATGG - Intronic
949474635 3:4431727-4431749 AGCCCTGAAGTCACAGACCAAGG + Intronic
950476833 3:13220098-13220120 AGCACTGAAGTGCCTAAAGCTGG - Intergenic
951320294 3:21236261-21236283 AGCCCTGAACTCTCCTAAGAAGG + Intergenic
953362111 3:42306652-42306674 TACCCTGAAGTCATTAAAGGTGG + Intergenic
954386934 3:50249079-50249101 AGTCCCGAAGTCACACAAGATGG + Intronic
954718735 3:52541713-52541735 AGCAGTCAAGTCACTAAAAATGG - Exonic
960885822 3:122393492-122393514 AGCCTTGCAGGCACTGAAGAAGG + Intronic
960891864 3:122457579-122457601 TGTCCTGAACTCACTAAATAAGG + Intronic
960970386 3:123135191-123135213 AGACCTGAAGTTACTAGAGAGGG - Intronic
961361854 3:126373128-126373150 AGCCCAGAGGTCACCAAGGAGGG + Intergenic
962419989 3:135219386-135219408 ATCACTGGAGTCATTAAAGAAGG + Intronic
962747821 3:138410614-138410636 GGGCCTGAAGTCAAAAAAGAAGG - Intergenic
966657980 3:182381547-182381569 AGCCCAGAAGTCTCTGAGGATGG + Intergenic
967341887 3:188407672-188407694 AGCCCTGAAGTCACTAAAGAAGG - Intronic
968251536 3:197220766-197220788 AACCATGAAGTCAATAAAAAGGG + Intronic
969320512 4:6409697-6409719 AGCCCTGGAGACACTAAGGTTGG + Intronic
976032796 4:80777446-80777468 AGCACTGAAGTAATTAAACAGGG - Intronic
978810195 4:112841042-112841064 AGCCCTGAAGGCATTTAAGAAGG - Intronic
978835880 4:113149154-113149176 AGCCCTGAAGTGAACAAGGATGG + Intronic
979494566 4:121369522-121369544 AGCCTTGAAGCCACCCAAGATGG - Intronic
983479454 4:168255125-168255147 AGCCAGGAAGTTACTTAAGATGG + Intronic
985369180 4:189267187-189267209 AGCCCTGAAATCAGGATAGAAGG - Intergenic
987539307 5:19233573-19233595 AGACCTAAAGTAACAAAAGATGG + Intergenic
991136098 5:63184435-63184457 GGCCCTGATCTCACTAAAGTTGG - Intergenic
994698353 5:103101226-103101248 AGCTATGAAGTGACTAATGATGG + Intronic
995195701 5:109364670-109364692 AACCCTGAAGTCACAAAATTTGG + Intronic
995759973 5:115552448-115552470 AGCCCTGAACTCAGTCATGACGG + Intergenic
996240546 5:121195274-121195296 AGCCCTGAAAGAACTAAAAAAGG + Intergenic
997781218 5:136660488-136660510 AACACTGAAGTCAGTGAAGATGG - Intergenic
1000312150 5:160055406-160055428 AGCCCTCTAATCACTAGAGATGG + Intronic
1000419861 5:161026405-161026427 GGCCATGAAGTCACAAAAGTAGG + Intergenic
1004150697 6:13117286-13117308 AACCCTAAACTCACTAAACATGG - Intronic
1006975175 6:38093726-38093748 AAGCCTGAAATCATTAAAGAGGG + Intronic
1007093179 6:39197023-39197045 ACCCCAGAAGTCACATAAGAAGG + Intronic
1007928278 6:45667830-45667852 AGCCATGGAGGCACTGAAGATGG + Intergenic
1008421349 6:51303232-51303254 AGCCCTGAAGGAACAAAATATGG - Intergenic
1011010208 6:82695120-82695142 ATCCCTGGAGTCACTGCAGAGGG + Intergenic
1012375439 6:98556364-98556386 CACCATGAAGTCACTAAACATGG + Intergenic
1015409757 6:132880054-132880076 AGCCCTGAAAAGACAAAAGAAGG + Intergenic
1016181159 6:141149622-141149644 AGACCGGAATTCATTAAAGAGGG + Intergenic
1021261573 7:18464807-18464829 AGTCCAGAACTCACCAAAGAGGG - Intronic
1021990865 7:26140104-26140126 AGGGCTGAAGTCTCTAAGGAAGG + Intergenic
1023405557 7:39830086-39830108 AGCACGGAAATCACTTAAGAAGG - Intergenic
1023488427 7:40711648-40711670 AGCGCTGAAGTTTCAAAAGATGG - Intronic
1025716884 7:63965846-63965868 GGCATGGAAGTCACTAAAGAGGG + Intergenic
1027938953 7:84648000-84648022 AGCTATGAAGTAACTAAAAATGG + Intergenic
1030141543 7:106309384-106309406 AGGCCAGAAGTAACTACAGAAGG - Intergenic
1031283265 7:119832805-119832827 AGCCCTTAAGTGACTGAAGAGGG - Intergenic
1033373416 7:140733267-140733289 CTCCTTGAAGTCAATAAAGAAGG - Intronic
1033954525 7:146829767-146829789 TGCTCTGAAGAGACTAAAGACGG - Intronic
1037419470 8:18686995-18687017 TGCCCTGAAGTCACAGAAGTAGG - Intronic
1040441419 8:47447027-47447049 ACCCCTGAAGTCACTGAAGAGGG - Intronic
1045718076 8:105072120-105072142 AGACCAGGAGTCAATAAAGAAGG + Intronic
1051342647 9:16126129-16126151 AACTGTGAAGTCACTGAAGAGGG + Intergenic
1053399255 9:37802587-37802609 AGACCTGAAGTTGCTAAGGAAGG + Intronic
1055909089 9:81326922-81326944 AGGCCTGAAGTCCCTGAAGCAGG + Intergenic
1059361341 9:113744180-113744202 GGTCCTGCAGTTACTAAAGACGG - Intergenic
1061787648 9:133039969-133039991 AGCCCTGAATTCATTAAGCACGG + Intronic
1186364830 X:8880289-8880311 AGCACTGTATTGACTAAAGATGG + Intergenic
1189554636 X:42129359-42129381 ATCCCTGATGTCATTAAGGAGGG + Intergenic
1190797944 X:53761224-53761246 AACCCTGCAGTCACTATACATGG + Intergenic
1190917215 X:54819986-54820008 AACCCTGCAGTCACTATACATGG - Intergenic
1192639335 X:72847495-72847517 TGCCCTGATGTCAAGAAAGAAGG + Intronic
1192642376 X:72873310-72873332 TGCCCTGATGTCAAGAAAGAAGG - Intronic
1193269344 X:79511048-79511070 CTCTCTGAAGGCACTAAAGAAGG - Intergenic
1194353062 X:92845221-92845243 AGTCCTGAAGTCAGAAATGAAGG - Intergenic
1195460550 X:105118538-105118560 AGAGCTGAAGTAACTAAAAATGG - Intronic
1195526339 X:105894453-105894475 AGAACTGAAGTCACAAAAGATGG - Intronic
1200661416 Y:5962308-5962330 AGTCCTGAAGTCAGAAATGAAGG - Intergenic
1201587826 Y:15580861-15580883 AGGGCTGAAGTCACTCAAGCTGG - Intergenic