ID: 967343741

View in Genome Browser
Species Human (GRCh38)
Location 3:188429660-188429682
Sequence CTCTATTATGAAAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967343741_967343745 18 Left 967343741 3:188429660-188429682 CCGTCTTCCCTTTCATAATAGAG 0: 1
1: 0
2: 0
3: 26
4: 288
Right 967343745 3:188429701-188429723 CTCGTCTTCTTTTCTTTAAGCGG 0: 1
1: 0
2: 1
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967343741 Original CRISPR CTCTATTATGAAAGGGAAGA CGG (reversed) Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
903616222 1:24659706-24659728 CTCTCTTGTGAAATGGAACAGGG + Intronic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
905081367 1:35323874-35323896 CTCTAGAATGAAAGGGAAATGGG - Intronic
905576013 1:39045178-39045200 CTCCAATATGAAAGGGATGAGGG + Intergenic
905593490 1:39185577-39185599 CTATAATTTGAAAGGGAGGAAGG + Intronic
907940300 1:59081236-59081258 CTTTTTTTTGGAAGGGAAGATGG + Intergenic
908115736 1:60938233-60938255 CTCTTTTTTGGAAGGGAGGAGGG + Intronic
908653769 1:66365472-66365494 CTCTGATGTGAAAGGGATGATGG - Intronic
909205235 1:72748131-72748153 ATCTATTATAAGAGAGAAGAAGG + Intergenic
910786805 1:91007834-91007856 CCTTAATATGAAAGAGAAGAGGG - Intronic
912074962 1:105862470-105862492 CCCTACTTTGGAAGGGAAGAGGG + Intergenic
912627825 1:111220852-111220874 ATCTGTTGTGAAAGGAAAGAGGG - Intronic
914225853 1:145719019-145719041 CTCCAGGCTGAAAGGGAAGAAGG - Intergenic
914916634 1:151823080-151823102 TTCTGTTAGGAATGGGAAGACGG + Intronic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
916378633 1:164183901-164183923 GTCCATTATGAAATGAAAGAAGG - Intergenic
917430689 1:174965238-174965260 ATCTTTTCTGAAAGGCAAGAGGG + Intronic
917955863 1:180097399-180097421 TTCAATTGTGAAAGGGTAGAAGG - Intronic
918912820 1:190595529-190595551 CTCTGTTATGAGAAGGAATAGGG + Intergenic
919505083 1:198388224-198388246 GTATATTATGAAAGTGAAGTTGG - Intergenic
921538523 1:216383309-216383331 TTCTATTCTGAAAAGGAACATGG - Intronic
921596178 1:217055913-217055935 ATCTACTATGAAAAGGAAAAGGG - Intronic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
1063083293 10:2789384-2789406 CTCTATTCTGAAAAGGATGCAGG + Intergenic
1063403594 10:5771697-5771719 CTTTGATATGAAAGGGAAGGAGG - Intronic
1063755319 10:9000943-9000965 ATCGCTTATGAAAGAGAAGAGGG + Intergenic
1063838519 10:10044017-10044039 CTCCATTATAAAAGGGATGGTGG + Intergenic
1065794450 10:29292932-29292954 CTCTAACATGAAAGGGCAGTAGG - Intronic
1066250377 10:33627094-33627116 TTCCATTATGAGTGGGAAGATGG + Intergenic
1069332999 10:67315663-67315685 CTCTATTTTTAAATGGAACAAGG + Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1071371287 10:84954126-84954148 CTCTATCAGGAAGGGGAAAAAGG - Intergenic
1072549068 10:96463506-96463528 CTCTGCTGTGAAAGGGCAGAAGG + Intronic
1072600145 10:96918239-96918261 CTCTATAATGACAGGGGGGATGG + Intronic
1073075317 10:100821846-100821868 CTTTATGATGACAGGGAAGGAGG + Intronic
1073832574 10:107402807-107402829 CTCTATTTGTAAGGGGAAGAAGG - Intergenic
1073891519 10:108107998-108108020 CTCTAATAAATAAGGGAAGAAGG - Intergenic
1074643357 10:115414653-115414675 TACTTTTATGAAAGGAAAGATGG - Intronic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1077846461 11:6030457-6030479 CTACATTATGAAAGGAAGGAAGG + Intergenic
1078045637 11:7912121-7912143 CTCCATCAAGAAAGGCAAGAGGG + Intergenic
1078750185 11:14154239-14154261 CTCTACTATGACAGTGCAGAGGG - Intronic
1079969623 11:27020270-27020292 CTCTATTGTGAGAGGAAAGAGGG - Intergenic
1082131056 11:48489803-48489825 TTCTTTGAAGAAAGGGAAGATGG - Intergenic
1084453955 11:69256721-69256743 CTCCCTTATGAGAGGGAGGAAGG + Intergenic
1086217817 11:84404982-84405004 CACTATTATAATAGGGAAAAGGG + Intronic
1086425092 11:86675015-86675037 GTCTATTACTAAAAGGAAGAAGG + Intergenic
1087332989 11:96806421-96806443 GTGTATTATGAAAGGGAAACAGG - Intergenic
1087349066 11:97008025-97008047 TTCTATGATCAAATGGAAGAGGG - Intergenic
1087537925 11:99475271-99475293 CTGTGTTATGACAGGGCAGATGG - Intronic
1088365445 11:109035593-109035615 CTATAATATGAATGGGTAGAAGG + Intergenic
1088519740 11:110682725-110682747 TTATATAATGGAAGGGAAGAAGG + Intronic
1088720923 11:112591026-112591048 CTTTATTGGGAAAGGGAGGAGGG - Intergenic
1089111992 11:116064486-116064508 CTCACCTATGAAAGGAAAGAAGG + Intergenic
1089755512 11:120683360-120683382 ATTTATTAAGAAGGGGAAGAAGG + Intronic
1090202815 11:124868275-124868297 ATCCCTTATGAAAGGCAAGACGG - Intronic
1090568713 11:128024299-128024321 TTGTTTTATCAAAGGGAAGAAGG + Intergenic
1092728718 12:11508722-11508744 CTCTATGATGTAAGAGGAGAGGG - Intergenic
1093151122 12:15623059-15623081 CTCTGTTAAGAAAGGGAAATTGG + Intronic
1093675889 12:21940305-21940327 TTCTGTTATGAAAGAGAAGCAGG + Intronic
1094777526 12:33747687-33747709 TTCTTTTATGAAAGAAAAGATGG + Intergenic
1095133233 12:38567846-38567868 CACCATTATGAAAGGGATTAAGG + Intergenic
1095498043 12:42806300-42806322 CTCGATTATTAAATTGAAGAAGG + Intergenic
1095779592 12:46044708-46044730 CTGAATTCTGAAAGGGAGGAGGG - Intergenic
1096627461 12:52904412-52904434 CTCCAGTTTAAAAGGGAAGAAGG + Intronic
1097341924 12:58448497-58448519 CTCTATACTGAAAGGGCAAAAGG - Intergenic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1099554658 12:84097029-84097051 CTCTTATATGAAAGGTCAGATGG - Intergenic
1099578927 12:84416744-84416766 CTCAATTTTGAAAAGGAAGTTGG - Intergenic
1100494290 12:95110302-95110324 CACTATTATTAAAGGAAAGCAGG + Intronic
1100879769 12:99003847-99003869 CTCTATAATGGAAGGCAACAAGG - Intronic
1103185476 12:118953414-118953436 ATCTAATAGGAAAAGGAAGAAGG - Intergenic
1103377326 12:120467714-120467736 TTCTATTATGAAAGGAATGAGGG + Intronic
1104232010 12:126894441-126894463 CTCTCTTATGAAAGGACTGAAGG + Intergenic
1104577328 12:129979873-129979895 CTGGAGGATGAAAGGGAAGAGGG + Intergenic
1105604865 13:21918817-21918839 ATCTATGATGAAAAGGAAGTAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107224392 13:38029838-38029860 CACAATTCTGAAAGGGTAGAGGG + Intergenic
1107428252 13:40315780-40315802 CTCTATCTTGAAAAGGATGAGGG - Intergenic
1107958070 13:45536108-45536130 CTCTATTTTGAGAAGGTAGAAGG + Exonic
1107971135 13:45643568-45643590 TTCTCTTATGAAAGGGAGGGGGG + Intergenic
1109236504 13:59827753-59827775 CTCTAATATGAATGGAAAGTGGG + Intronic
1111249409 13:85583976-85583998 CTTTAATATGACAGGGAAGGTGG - Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1114080089 14:19196271-19196293 CTGAATTCTGAAAGGGAAGAGGG - Intergenic
1114895160 14:26980220-26980242 CTCTTTTATGGAAGGGAAGTGGG + Intergenic
1115042190 14:28944573-28944595 CTATATTTTGAAAGGGAACTTGG - Intergenic
1116336202 14:43659840-43659862 CGCTATTATCAAAGTGAAGATGG + Intergenic
1118088774 14:62448776-62448798 CTCCATTATAAAAGAGAAGTGGG + Intergenic
1120060701 14:79978893-79978915 CTCTATTATGGCAGTGCAGAAGG + Intergenic
1120913078 14:89685487-89685509 TTCTTTTATAAAAGGGAGGAGGG + Intergenic
1120977006 14:90257554-90257576 CTGTATCATGAACGGCAAGAAGG + Intronic
1121849699 14:97209525-97209547 CTCCATCATGAAAGAGAACAGGG - Intergenic
1124125569 15:26935796-26935818 CTCAAGGATGAAAGGGAAGCAGG - Intronic
1124841078 15:33242800-33242822 TTCTTTTATGGAAGGGAAGTGGG + Intergenic
1125088906 15:35767726-35767748 ATGTATTATGGAAGAGAAGAGGG - Intergenic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1126776260 15:52103184-52103206 CATTATTATAAAAGGAAAGAAGG - Intergenic
1127372262 15:58352554-58352576 TTCTCTTATAAAAGGGAAGGGGG - Intronic
1128070990 15:64796898-64796920 CTCTATTAAAAAAGAAAAGAGGG - Intergenic
1128105500 15:65041643-65041665 TTCTCTTATTAAAAGGAAGAAGG + Intergenic
1129380402 15:75161438-75161460 TTCTATCATGACAGGGGAGAGGG - Intergenic
1129522556 15:76195000-76195022 CTCTAGAATGAAAGGCAAGCTGG - Intronic
1129554298 15:76489021-76489043 CTTTCTTATAAAAGGCAAGATGG - Intronic
1131850250 15:96534846-96534868 CTATATTTTTAAAGGCAAGAGGG - Intergenic
1132351811 15:101144118-101144140 CTCTTTTATGAAAAGAAACAGGG + Intergenic
1133458880 16:5969239-5969261 ATTTATTATGAAAGAGAAAAAGG - Intergenic
1135023296 16:18980277-18980299 CTCCAGTAAGGAAGGGAAGAGGG + Intergenic
1135074886 16:19384728-19384750 CTCCAGTAAGGAAGGGAAGAGGG - Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1139966403 16:70747890-70747912 CTCTGTTCTGACAGGGAAGTAGG - Intronic
1140275422 16:73504517-73504539 GACAATTATCAAAGGGAAGAGGG + Intergenic
1140341071 16:74162817-74162839 CTCTATAATGAGAGGACAGAAGG + Intergenic
1142819185 17:2451189-2451211 CTTTATTTTCAAAGGGAAAAAGG - Intronic
1143563095 17:7706561-7706583 CTCTTTTATGAGCGGGAAGTGGG - Intronic
1144448225 17:15351831-15351853 ATCTATTATAGAAGGGAAGTTGG - Intergenic
1148022256 17:44561189-44561211 CACTGTTAAGAAATGGAAGATGG - Intergenic
1148968101 17:51455019-51455041 TTCTATGATGAAAGTGAATAGGG + Intergenic
1149379173 17:56075724-56075746 ATTTAACATGAAAGGGAAGAAGG + Intergenic
1149611529 17:57960832-57960854 ATCCCTTATGCAAGGGAAGAAGG - Intergenic
1150978827 17:70119401-70119423 CTCTACTAGGGAAGGGCAGAGGG - Intronic
1151343164 17:73484818-73484840 CTCTATTAAGAAAGAAAAGTGGG - Intronic
1153536727 18:6109854-6109876 CTCTTTTATTTAAGGGAAAAAGG - Intronic
1157860056 18:51133196-51133218 TCCTATGATGAAAGGGAAGGTGG - Intergenic
1158210196 18:55040456-55040478 CTCTTTTCTAAAAGAGAAGAGGG + Intergenic
1158233942 18:55291489-55291511 CAGCTTTATGAAAGGGAAGATGG - Intronic
1158617484 18:59001584-59001606 CTGAATTCTGAAAGGGAGGAGGG + Intergenic
1159429786 18:68336826-68336848 CTCTTCTATGAAAGGGAAGGAGG - Intergenic
1159995194 18:74957664-74957686 TTCTATTATGAGAGGAAGGAAGG + Intronic
1161874251 19:6895357-6895379 TTCTATTATTATAAGGAAGAGGG + Intronic
1164470669 19:28528625-28528647 TTCTCTTATAAAAGGGAAGGGGG + Intergenic
1164801039 19:31076898-31076920 CTCTCTTATAAAAGGGAGGAAGG - Intergenic
925004423 2:429969-429991 CTCTTTTATGAACGGGACGTGGG + Intergenic
925393147 2:3512717-3512739 CTCTACTATGACAGTGCAGAGGG + Intronic
927102581 2:19799437-19799459 TGCTATGATGGAAGGGAAGAAGG + Intergenic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929212305 2:39370444-39370466 CTCTATGATGAAAGATAAGGAGG + Intronic
929670612 2:43874427-43874449 CTTTACTATGAACTGGAAGACGG + Exonic
930432644 2:51299774-51299796 CTCTAGCATGAAAGGGAAAAAGG + Intergenic
931077376 2:58731169-58731191 CTCAATAAAGAAAAGGAAGAAGG - Intergenic
931256068 2:60573996-60574018 GTCAATTATGAAAGAGAAGATGG - Intergenic
932184084 2:69676903-69676925 ATCTATTAGGAATGGGAATAGGG - Intronic
935415116 2:102807202-102807224 CTAGAAAATGAAAGGGAAGAGGG + Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
936646494 2:114378131-114378153 CTCAATCATCAAAGGCAAGATGG - Intergenic
939586982 2:144017820-144017842 CTCAATTATGAAAGGGCCAATGG - Intronic
939608233 2:144278406-144278428 CTGTAGTATGAAAGGAAGGAAGG + Intronic
939643555 2:144669531-144669553 CTCAATCATGAAACAGAAGATGG - Intergenic
939907575 2:147936306-147936328 CCCTATTAAGATGGGGAAGATGG - Intronic
940106937 2:150111655-150111677 CCCTTTTAAGAAAGGAAAGAAGG - Intergenic
941887103 2:170539492-170539514 CTCTCTTGTGAAATGAAAGAAGG + Intronic
942699980 2:178695945-178695967 GAATACTATGAAAGGGAAGAAGG - Exonic
943094739 2:183415821-183415843 CTAAATTAGGAAAGGGAAAATGG + Intergenic
944827148 2:203496050-203496072 CTATTTTATTAATGGGAAGAAGG - Intronic
944953083 2:204775618-204775640 CTGTATTATGACAGAGAAAATGG - Intronic
945965638 2:216183652-216183674 TTCTGTTCTGAAAGGGAAGCAGG + Intronic
946610380 2:221451318-221451340 CATTACTATAAAAGGGAAGAGGG + Intronic
947308785 2:228777619-228777641 CTCTATTAGGCAAGAAAAGACGG + Intergenic
947781443 2:232768630-232768652 CTCTATCAGGAAAGAGAAAATGG - Exonic
1169096341 20:2902373-2902395 CTCAATTAAGAAAGGGAGTAGGG - Intronic
1170713925 20:18816258-18816280 CTCTAATATGAAATGGAGGAAGG - Intronic
1174654656 20:52160711-52160733 CTCTGTTGTGAAAAGGAAAAAGG - Intronic
1174781208 20:53390540-53390562 CTCTCTTGTGCCAGGGAAGAAGG - Intronic
1176846507 21:13880829-13880851 CTCTATTATGGAAGTGCAGAAGG + Intergenic
1178107113 21:29332235-29332257 GTCAATTAAGAAAGGGAAAATGG - Intronic
1179723068 21:43326321-43326343 CTCTATTATGAAAAATAAGCTGG - Intergenic
1180500685 22:15926429-15926451 CTGAATTCTGAAAGGGAAGAGGG + Intergenic
1182645724 22:31807816-31807838 CTCTACTAGGAAAGGGCAGAGGG - Intronic
1183039935 22:35170325-35170347 TTCTATTCAGAAAGGGCAGAAGG - Intergenic
1183113727 22:35673418-35673440 TTCTCTTATAAAAGGGAGGAGGG + Intergenic
1185093169 22:48787202-48787224 CACTATTATCAAAAGGATGAAGG - Intronic
949402642 3:3682068-3682090 CTCCTTAATTAAAGGGAAGAAGG - Intergenic
952022174 3:29036333-29036355 CTCTTTTATAAAACAGAAGACGG - Intergenic
952381896 3:32811828-32811850 TTCTATTATGGAGGGGAAGGAGG + Intergenic
956061487 3:65352563-65352585 CTCTATTAAAATGGGGAAGAAGG - Intergenic
958881703 3:99679455-99679477 CTCTATTATAGAAGGACAGAGGG - Intronic
959400581 3:105896846-105896868 CCCTATTATTAAAAGCAAGATGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960540420 3:118855422-118855444 CTGTATAATGGAAGAGAAGAAGG - Intergenic
960588589 3:119344263-119344285 CTCTAATCAGAAAGGGAAGGAGG + Intronic
961976530 3:131030754-131030776 CTCTACTATGAAAGTGTAGAGGG - Intronic
962140169 3:132781999-132782021 GTCTATTACTAAAAGGAAGAAGG - Intergenic
963399827 3:144784046-144784068 TTCTAGGATGGAAGGGAAGAAGG + Intergenic
963755199 3:149227872-149227894 CTCTATCATGAAAGGAACAAGGG - Intergenic
964312012 3:155404097-155404119 CTGTATGATGAATGGGCAGAGGG - Intronic
964404050 3:156330125-156330147 CTTTATTATAAAAGGGGGGATGG - Intronic
964499217 3:157330267-157330289 CTCTCTTGTGAAAGGGAATCTGG + Intronic
965055139 3:163701443-163701465 CTCTAGTATGACAGCCAAGAAGG - Intergenic
967343741 3:188429660-188429682 CTCTATTATGAAAGGGAAGACGG - Intronic
967462279 3:189760753-189760775 CTCTATTAGGGCAGGGCAGAAGG - Intronic
967661633 3:192117853-192117875 TTATATTCCGAAAGGGAAGAAGG + Intergenic
968850710 4:3075518-3075540 TTCTAGTCTGAGAGGGAAGAGGG + Intronic
969897148 4:10316089-10316111 CTTTAGTATAAAAGGGGAGACGG + Intergenic
972082903 4:35175823-35175845 TTCCATTATGATAAGGAAGAAGG - Intergenic
974289921 4:59916019-59916041 TTCTGTTATGAAAGTAAAGATGG + Intergenic
976644009 4:87368515-87368537 TTCTCTTATAAAAGGGAAGGGGG + Intronic
976869224 4:89770179-89770201 GTCTTTTATTTAAGGGAAGAAGG + Intronic
977590235 4:98818186-98818208 TTCTCTTATAAAAGGGAAGGGGG + Intergenic
979067231 4:116153359-116153381 GTCAATTAAGAAAGAGAAGAAGG + Intergenic
979712126 4:123791991-123792013 CCCTATTTTGAAAAGGCAGAGGG + Intergenic
980348354 4:131654114-131654136 CTTTATTATGAAAGAGGAAATGG + Intergenic
981108394 4:140906819-140906841 CTCTAGTCTGAGATGGAAGAAGG + Intronic
981602024 4:146500722-146500744 CTCTGTGATGAAAGGGAAAAGGG - Intronic
984292518 4:177813324-177813346 TTCCATTAAGAAAGAGAAGATGG - Intronic
985815499 5:2125230-2125252 CTCTGATATGAAGTGGAAGAGGG + Intergenic
989050912 5:37319442-37319464 CTCTATTGTTAAAGGTAAGGGGG + Intronic
989564045 5:42883802-42883824 CTGAATTCTAAAAGGGAAGAGGG - Intronic
990216997 5:53545223-53545245 CTCTATTTTCAAAAGGAAAAAGG + Intergenic
991608349 5:68425568-68425590 CCCAATAATAAAAGGGAAGAGGG + Intergenic
993442963 5:87978842-87978864 CTCTACTGGGAAAGTGAAGAGGG + Intergenic
993801938 5:92352531-92352553 AACTATGATGAAAGGCAAGAAGG - Intergenic
994614531 5:102087315-102087337 CTCTTTTAAGAAAGAGAAAAAGG - Intergenic
997132393 5:131290172-131290194 AGCTATTGTGAAAGGAAAGATGG + Intronic
997165902 5:131660009-131660031 CCCCATTATGGAGGGGAAGACGG + Intronic
997237850 5:132284313-132284335 CTCTCCTATAAAAGGGGAGATGG - Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
998603271 5:143606606-143606628 CTGAAGTATGAAAGGGAATATGG - Intergenic
999902414 5:156099092-156099114 CTCTTTTATCAAAAAGAAGAAGG - Intronic
1000070452 5:157735740-157735762 CTTTACTATGAAAGAGGAGAGGG + Intronic
1000179379 5:158793013-158793035 CTAAATTATGAAAGTTAAGAAGG + Intronic
1000185055 5:158851346-158851368 CGCTGTCAAGAAAGGGAAGAAGG + Intronic
1001762871 5:174222403-174222425 CTCTAATATGACAGGCATGAGGG + Intronic
1002589876 5:180283124-180283146 TTCTCTTATGAAAGCGAGGAAGG - Intronic
1004632559 6:17436129-17436151 CTCTATCAAGAAAGGAAGGAAGG - Intronic
1005384941 6:25276887-25276909 CATTATTTTGAAAAGGAAGATGG - Intergenic
1005410668 6:25542285-25542307 CTTTCTTAGGAAAGGGCAGAAGG + Intronic
1005673344 6:28129120-28129142 CAATACTATGTAAGGGAAGACGG - Intronic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006993786 6:38238893-38238915 CTGAATTCTAAAAGGGAAGAGGG + Intronic
1007771259 6:44194301-44194323 CTCTCTTATTAAGAGGAAGATGG + Intergenic
1009374128 6:62946715-62946737 CTCAATTCTGAAAGGTAAGGAGG + Intergenic
1009770550 6:68138636-68138658 CTCTACTATCAAAGGCAAGGGGG - Intergenic
1009843474 6:69106482-69106504 CTTTCTTATGGAAGGGAGGAGGG - Intronic
1010114664 6:72288727-72288749 CTGAATTATGAAGGGGAAGCTGG - Intronic
1010360469 6:74987293-74987315 CTCTATTAGGACAGTGCAGAGGG + Intergenic
1011193057 6:84753574-84753596 CTCAACTATGTAAGGGTAGAGGG + Intronic
1011583103 6:88894049-88894071 CTCTAACATGAAAATGAAGATGG - Intronic
1012001697 6:93662680-93662702 CTCAATCATGAAAGGCAAGGTGG + Intergenic
1012298673 6:97556836-97556858 CTCAATTATGAAATTGTAGAAGG - Intergenic
1013123003 6:107157449-107157471 CCCTATAATTAAAGGGGAGAAGG - Intronic
1013841990 6:114407514-114407536 CTCTATTTGGAAATGCAAGAGGG - Intergenic
1014355987 6:120410835-120410857 CTCAAGTAGGAAAGGGATGATGG + Intergenic
1014510335 6:122313133-122313155 TTTTATTATGAAAGGGAAATAGG - Intergenic
1014591385 6:123276089-123276111 CTCTTTTGTGAATGGGAACAAGG - Intronic
1015167123 6:130210757-130210779 CTCAATTCTAAAAGGGAGGAGGG - Intronic
1015296557 6:131599975-131599997 CACCATTGTGAATGGGAAGAAGG + Intronic
1015464550 6:133534152-133534174 TTCTTTTATGAAAGGGAAAAAGG - Intergenic
1015771580 6:136773581-136773603 ATCTAGTGAGAAAGGGAAGATGG - Intronic
1016108761 6:140194930-140194952 TTCTCTTATAAAAGGGAGGAGGG + Intergenic
1016128343 6:140434215-140434237 CTCTATTAGGGAAGTGCAGAGGG + Intergenic
1016294678 6:142562278-142562300 CTCTATTCTCACAGGGAAGAGGG + Intergenic
1017271954 6:152517579-152517601 CTCTCTTATGAATGGGAATTGGG - Intronic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1019002161 6:168763409-168763431 CTGTATTTTGAAATGTAAGAAGG - Intergenic
1021386959 7:20043252-20043274 AGCTATTATGAAAGAGAAGCTGG + Intergenic
1021400960 7:20209126-20209148 CTCTACTAGGGCAGGGAAGAAGG + Intronic
1023671018 7:42576776-42576798 CTCCATGATGGAAGTGAAGAAGG + Intergenic
1024110257 7:46137857-46137879 CTGTATTTTGAATGGGAGGATGG - Intergenic
1024383183 7:48722806-48722828 CTCTATTAGGACAGTGCAGAGGG - Intergenic
1026211521 7:68310119-68310141 CTCTATTATCTAAGAGAGGAAGG + Intergenic
1026287943 7:68980023-68980045 ATATATTCTGTAAGGGAAGAGGG + Intergenic
1026861226 7:73791178-73791200 TTCTCTTATAAAAGGGAAGGGGG + Intergenic
1028126692 7:87120991-87121013 CTATATTATGCAAGGCAAAATGG - Intergenic
1029129501 7:98319212-98319234 CTCTATAGAGCAAGGGAAGATGG + Intronic
1029205207 7:98865726-98865748 CTCTATTATGAGGGGGGAGGGGG + Intronic
1030676366 7:112390014-112390036 TTCTCTTATAAAAGGGAGGAAGG - Intergenic
1032260876 7:130335911-130335933 CTACATAAAGAAAGGGAAGAAGG + Intergenic
1033578326 7:142708397-142708419 TTCTCTTATAAAAGGGAAGGAGG + Intergenic
1034165517 7:149022203-149022225 CTCAAGTGTGAAGGGGAAGAGGG + Intronic
1036043052 8:5107742-5107764 CGCTAATATGAAAGGGGAGAAGG + Intergenic
1037724245 8:21469984-21470006 GTCTACAAAGAAAGGGAAGAAGG - Intergenic
1037845959 8:22282525-22282547 CTCTATTCTGCTATGGAAGATGG + Intronic
1038129897 8:24718136-24718158 CTATATTTTTAAAGGGAGGAGGG + Intergenic
1039000626 8:32975582-32975604 CTCTTTTATTAAGGGGATGAAGG - Intergenic
1039279666 8:35970170-35970192 GTGCATTCTGAAAGGGAAGAAGG + Intergenic
1039595561 8:38787506-38787528 CTCCATTTTGAAAGGGAAAAAGG + Exonic
1041378068 8:57222487-57222509 CTCCATTACCAAAAGGAAGAGGG - Intergenic
1041955448 8:63554005-63554027 CTCTACTAAGATAGGGTAGAAGG - Intergenic
1043063795 8:75540583-75540605 CGCAAATATGAAAGGGAATAAGG + Intronic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044433415 8:92135059-92135081 CTCTACTATAAAAGGCAATATGG + Intergenic
1044540406 8:93402736-93402758 CTCTGTTATTTAAAGGAAGAGGG + Intergenic
1045129055 8:99127834-99127856 CTGTATTTTAAAAGGTAAGAAGG + Intronic
1046351034 8:113012785-113012807 CTGTATTATCAAAGGGATGTTGG - Intronic
1046529467 8:115424958-115424980 TTCTATTTTGGAGGGGAAGAGGG - Intronic
1046735183 8:117768895-117768917 CTCTATTATGGCAGTGCAGAGGG + Intergenic
1048106219 8:131413191-131413213 GTCTACTAAGAAAGGGAAGCAGG + Intergenic
1048399734 8:134053356-134053378 CTCTTTTATAACAGGGAACATGG - Intergenic
1048600519 8:135914602-135914624 TTCTAAGAAGAAAGGGAAGAAGG - Intergenic
1048655122 8:136527695-136527717 CTCAAGTCTGAATGGGAAGATGG + Intergenic
1052170798 9:25393916-25393938 CCATAATATGAAAGGGAAAAGGG + Intergenic
1052223907 9:26060810-26060832 ATTTATTATGTATGGGAAGAGGG - Intergenic
1052558791 9:30056394-30056416 CTACATTATGCAAGGGAAAAAGG - Intergenic
1052663399 9:31464781-31464803 TTCTCTTATAAAAGGGAAGGGGG - Intergenic
1058323877 9:103670996-103671018 TGCTATTATGAAAAGGAAAAAGG + Intergenic
1058367647 9:104229322-104229344 CTCTATTAAGATTGGGAATAAGG + Intergenic
1058435355 9:104957370-104957392 CTCTATCATAAAAGGAAAGAAGG + Intergenic
1058477779 9:105357110-105357132 CTCTCTAATGACAGGAAAGACGG - Intronic
1058713306 9:107700147-107700169 CTCTAATGTGAAAAGAAAGAAGG + Intergenic
1059007031 9:110414076-110414098 CTCTGTTTTGAAAGTGAAGAAGG + Intronic
1062732153 9:138116086-138116108 CTCTTGTCTGAAAGGGAAGCAGG - Intronic
1189494919 X:41500060-41500082 CTCTCTTGTGGATGGGAAGATGG - Intergenic
1190362868 X:49665805-49665827 CTGGACTCTGAAAGGGAAGAGGG + Intergenic
1192040904 X:67620415-67620437 CTCTAGTACCAAGGGGAAGATGG + Intronic
1193726527 X:85046379-85046401 ATTTATTAGGAAATGGAAGATGG + Intronic
1193806143 X:85997251-85997273 CTGTACTATGAAAGGCAAAAGGG - Intronic
1195330030 X:103789455-103789477 AGCTATTCTGAAAGGCAAGAAGG + Intronic
1198852347 X:140978654-140978676 GTCTATTTTGAAATGGGAGAAGG - Intergenic
1199976182 X:152896167-152896189 CCCTAGTTTGAAAGGGTAGAAGG - Intergenic
1200877129 Y:8169378-8169400 CTTTAATATGAATGGGTAGAGGG - Intergenic
1201699776 Y:16867843-16867865 CTCTGCTTCGAAAGGGAAGAAGG + Intergenic