ID: 967344773

View in Genome Browser
Species Human (GRCh38)
Location 3:188442505-188442527
Sequence TCTGATATTTAGATAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967344773 Original CRISPR TCTGATATTTAGATAGTGGA TGG Intronic
906376027 1:45297369-45297391 TATGATATTTAGGTGGTGGGAGG + Intronic
909350828 1:74651533-74651555 TCTGAGATTTAGAAAGGGTAAGG - Intronic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
910268817 1:85370275-85370297 TCTGATATCAAGGTATTGGAAGG - Intronic
910554162 1:88512013-88512035 TCTGATATGTTGATAATGAAAGG - Intergenic
910704223 1:90109666-90109688 TTTGCTTTTTAGAGAGTGGAGGG + Intergenic
911822659 1:102440395-102440417 TATGATATTTAGATAGTACACGG - Intergenic
912546833 1:110457127-110457149 TCTGATATTGACATATTAGAAGG + Exonic
913025757 1:114837916-114837938 TTTGATATTTATAGAGTAGAAGG + Intergenic
915580674 1:156811214-156811236 AACGATATTTAGACAGTGGAAGG - Intronic
915727636 1:158029512-158029534 TCTTATATTTAGATAATGATGGG + Intronic
916874910 1:168958797-168958819 TCTCATGTTGAGATAGGGGAAGG - Intergenic
916994991 1:170286976-170286998 TCTGATATTGAGTTAATGGCAGG + Intergenic
918808594 1:189084614-189084636 TCTGATATTTTAATAATAGATGG + Intergenic
921490807 1:215773352-215773374 TATGACATTTACATAGTGGGAGG - Intronic
921618485 1:217299646-217299668 TCTGATATTCAAATGATGGAGGG + Intergenic
922608662 1:226908008-226908030 TCTCATATTTATAAAGTGAAGGG + Intronic
924153849 1:241155813-241155835 TCTCATATTTAGATACTGTCTGG + Intronic
1064543118 10:16425063-16425085 TCTGATATTTAGATGGTAATAGG - Intergenic
1069341753 10:67417748-67417770 CCTCATATTTATACAGTGGATGG - Intronic
1072388179 10:94954309-94954331 TGTGACATTTACATAGTGGGTGG - Intronic
1073502270 10:103951163-103951185 TTTGATACTTAGAGAGGGGAAGG + Intergenic
1074240058 10:111629455-111629477 TATGACATTTACATAGTGCACGG + Intergenic
1074343972 10:112662797-112662819 TCTTGTATTTAGATAATAGAAGG + Intronic
1078570460 11:12453242-12453264 TCTGATATTTAGAGATAGGAGGG + Intronic
1081847247 11:46249558-46249580 TCTGTTATTTAAAAAGGGGATGG - Intergenic
1084345415 11:68544054-68544076 GCTGATATCCAGATACTGGAAGG + Intronic
1085636894 11:78165916-78165938 TGTGATATTTACATAGCGCAAGG + Intergenic
1093023459 12:14223418-14223440 TGTGTTATTAAGATAGAGGAAGG - Intergenic
1094082210 12:26549465-26549487 TCTGATATTTTAAAACTGGAAGG - Intronic
1094248215 12:28327476-28327498 TGTGACATTTACATAGTGCAAGG - Intronic
1095685654 12:45030263-45030285 TCTGATGTTTAGAAAGTGACTGG - Intronic
1097813306 12:64042730-64042752 TCTGTCATTTAGAGAGTGAATGG - Intronic
1099141479 12:78981891-78981913 TCTTAAATTTGGATAGTTGAAGG + Intronic
1099327479 12:81237453-81237475 TCTGATATTTAGGTAATGTTGGG + Intronic
1099616301 12:84939665-84939687 TCTGCTATTAAGATACTTGAAGG - Intergenic
1101801036 12:108022122-108022144 ACTGATGGGTAGATAGTGGATGG - Intergenic
1104351176 12:128045245-128045267 TATGACATTTACATAGTGCATGG + Intergenic
1106233552 13:27841409-27841431 TCTGATAACTAGATAGTGTGGGG - Intergenic
1108434384 13:50387311-50387333 GCTGATATTTAGATTGTGGTGGG + Intronic
1109005254 13:56866870-56866892 ACTGATATTTTGATAGTGTTTGG - Intergenic
1109852528 13:68085893-68085915 GCTGATATTTAGATACTGTGAGG + Intergenic
1110091450 13:71453915-71453937 ACTGATATTTAGACAGTATATGG + Intronic
1115031100 14:28795015-28795037 TCTAATATTTAGATAGATTACGG + Intronic
1115126431 14:30000101-30000123 TTTGATATATACATAGAGGATGG + Intronic
1115929133 14:38471178-38471200 TCAGAAATTCAGATAGTGGGAGG - Intergenic
1116240440 14:42335983-42336005 TCTGATATTTCTGTAATGGAAGG + Intergenic
1117459605 14:55931981-55932003 TCTGATGTTTACATAGTGCGGGG - Intergenic
1117597444 14:57337975-57337997 TCTGATATTTAAATAATTCATGG + Intergenic
1125038308 15:35152903-35152925 TCTGAGATTTAGCTAGGGCAGGG + Intergenic
1127475798 15:59331679-59331701 AATGAAATTTAGATGGTGGAAGG - Intronic
1127723449 15:61725155-61725177 TCAGATAATTAAATAGTGGAGGG + Intergenic
1128766971 15:70257190-70257212 GCAGATATTTAGATACAGGATGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130191669 15:81742546-81742568 TCTGTTATTAAAATAGTGGTTGG - Intergenic
1132008221 15:98250043-98250065 TCTTTTATTTGGAAAGTGGAAGG - Intergenic
1139128922 16:64116544-64116566 TCTGATATTGATATAGGAGAAGG - Intergenic
1141356531 16:83351953-83351975 GCTGTTTTGTAGATAGTGGATGG + Intronic
1203140564 16_KI270728v1_random:1762812-1762834 TCAGATATTTAGAAGGTGGCTGG + Intergenic
1153482590 18:5562526-5562548 TTTGATATTTATAAAGGGGATGG + Intronic
1155757855 18:29524297-29524319 AATGATACTTAGATAGAGGATGG + Intergenic
1156925064 18:42566372-42566394 TCTGATATAAAGTTAGTGTAGGG + Intergenic
926343340 2:11922944-11922966 TTTGATATATAGATAGCGCATGG - Intergenic
933202156 2:79463731-79463753 TCTGAGATCTCGAGAGTGGAAGG + Intronic
934564700 2:95331825-95331847 TCAGATATTTTGACAGTGGGAGG + Intronic
936505483 2:113102411-113102433 TTTGATATGTGGATTGTGGAGGG + Intergenic
943292985 2:186099389-186099411 ACAGATATTGAGATAGTGGAAGG - Intergenic
948738544 2:240026581-240026603 TCTGGTTTTTAGATCCTGGAGGG + Intergenic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1169485562 20:6028301-6028323 TATGTTAATTAGAGAGTGGAAGG + Intronic
1169513580 20:6292542-6292564 TCTGATCTTCAGCTAGTGGCTGG + Intergenic
1173236445 20:41250110-41250132 CCTGATATCTAGGTAGAGGAGGG - Intronic
1173325460 20:42028971-42028993 ACTGATTGCTAGATAGTGGAGGG + Intergenic
1174766461 20:53258551-53258573 TCTGATATGTAGATAGGGAGAGG + Intronic
1177364100 21:20111590-20111612 TCTGACATATACATAGTGTATGG + Intergenic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1178935276 21:36856397-36856419 TCTGCTATTTAGACTGCGGAAGG + Intronic
1179638094 21:42727038-42727060 TCTAACATTTAGATAGGGAAAGG - Intronic
1181999599 22:26909399-26909421 TCTGAGGTTTAGAGAGGGGAGGG + Intergenic
1183139601 22:35924217-35924239 TCTGAAATTAAGATAATGTATGG + Intronic
1184522747 22:45005246-45005268 GCTGTGATTCAGATAGTGGAGGG - Intronic
949225764 3:1693259-1693281 TATGACATTTACATAGTGCATGG - Intergenic
951014610 3:17716366-17716388 TTTGAAATTTACTTAGTGGAGGG + Intronic
959851529 3:111093834-111093856 TTAAATATTTAGATAGTGGATGG + Intronic
960119431 3:113932320-113932342 TCTGGTATTTTGGTATTGGAGGG + Intronic
960225166 3:115159487-115159509 TTTGATGTATACATAGTGGATGG + Intergenic
960330047 3:116348081-116348103 TGTGAAATTTCGAGAGTGGAAGG - Intronic
961976836 3:131034681-131034703 TCTAATATTTAAATTGTGGCCGG - Intronic
962202454 3:133413009-133413031 TCTGTTTCTTAGAAAGTGGAGGG + Intronic
965196286 3:165599988-165600010 TCTGATATTTAAAAAGAGTAAGG - Intergenic
965202360 3:165676072-165676094 TATGATACTTATATAATGGATGG - Intergenic
967344773 3:188442505-188442527 TCTGATATTTAGATAGTGGATGG + Intronic
967563624 3:190947435-190947457 TCTCATATTTTGATAGAAGAAGG - Intergenic
969399928 4:6947720-6947742 TCTAATATTTAAATACAGGAGGG - Intronic
970215154 4:13751204-13751226 TATGATATTTAGAAAGAGTAGGG + Intergenic
971765987 4:30832730-30832752 TCTGGTATCTAGACAGTGTATGG - Intronic
971851229 4:31988397-31988419 TTTGTTATTTAGGTAGAGGATGG - Intergenic
972380535 4:38515460-38515482 ACTAATATTTATATAGTAGATGG + Intergenic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
976391753 4:84512802-84512824 TCTGATACTGAGAAATTGGATGG + Intergenic
977337582 4:95718091-95718113 TCAAATCTGTAGATAGTGGAGGG - Intergenic
978726927 4:111979580-111979602 TCTGATATTTGGATAGCTAAAGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983677307 4:170310669-170310691 TCAGATATTTAGAAAGAGAAAGG + Intergenic
983706172 4:170662391-170662413 TATGACATTTACATAGTGCAGGG - Intergenic
984436885 4:179720362-179720384 TATGACATTTACATAGTGCAGGG + Intergenic
985343487 4:188976094-188976116 TCTTATATTTTGCTGGTGGAAGG - Intergenic
987231998 5:15903868-15903890 TCTGATTTTTATATTGTGAAAGG - Intronic
994700545 5:103127786-103127808 TCAAATATTTCGATAATGGAAGG - Intronic
997904064 5:137797212-137797234 CCTGATATATTGATAATGGAGGG - Intergenic
998181611 5:139949954-139949976 TTTGCTATTTAGACAGAGGAAGG - Intronic
1006061519 6:31423714-31423736 TGTGATGTTTACATAGTGCATGG + Intergenic
1008248284 6:49206166-49206188 TCAGAAATACAGATAGTGGAAGG + Intergenic
1012595897 6:101038782-101038804 TCTGATATTTATATAGATAACGG + Intergenic
1014252321 6:119127557-119127579 TCACATAATTAGATAGTGGCAGG - Intronic
1016104518 6:140145787-140145809 TATGATATCTACATAGTGGGAGG + Intergenic
1018752585 6:166820343-166820365 TCTGAGATTGAGATAGAGGAAGG - Intronic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1025952580 7:66157195-66157217 TCTGATATTTAGATTTTCTAAGG - Intergenic
1028251017 7:88540211-88540233 TATGACATTTACATAGTGCATGG + Intergenic
1036960973 8:13244223-13244245 TCTGATTTTTAGGCAATGGAGGG - Intronic
1041727046 8:61028180-61028202 AGTGATGTATAGATAGTGGAAGG + Intergenic
1041860254 8:62504641-62504663 TCTGATAATGAAATAATGGATGG - Intronic
1041887564 8:62828973-62828995 TCTGAAATTTAGAAAGTGCTTGG - Intronic
1042283064 8:67076110-67076132 TGTGATATGTAGATAGTGGCAGG - Intronic
1043660375 8:82733418-82733440 TTTGATATTTTAATAGTGTAAGG - Intergenic
1043779912 8:84319511-84319533 TGTGATATTCAGACAGAGGAAGG + Intronic
1044245168 8:89935636-89935658 AATGATATTTAGATAAGGGATGG + Intronic
1044525593 8:93247275-93247297 TCTGAAACATTGATAGTGGATGG - Intergenic
1044526249 8:93254909-93254931 TCTGAGATTTAGATTGGGAATGG - Intergenic
1046367533 8:113255167-113255189 TTTTATATTTAGATAGTCTAAGG - Intronic
1046642251 8:116745352-116745374 TTTGATATGAAGATAGTGAATGG - Intronic
1055931701 9:81565945-81565967 TCTGATTTTAAAATACTGGATGG + Intergenic
1057008660 9:91582928-91582950 TCTGATAACTACATAGAGGAAGG - Intronic
1058622288 9:106896258-106896280 TCAAATGTTTAGTTAGTGGATGG + Intronic
1059178995 9:112194044-112194066 TGTGTTATTTATATAGTGGCTGG + Intergenic
1189265583 X:39713562-39713584 TTGGATGTTTAGAGAGTGGATGG + Intergenic
1189516356 X:41716835-41716857 TCTGACATTCAGATAGAGTAAGG - Intronic
1190931103 X:54950394-54950416 GCTGCACTTTAGATAGTGGATGG + Intronic
1191957182 X:66656551-66656573 CTTGATATTTTGATAGTGGTTGG - Intergenic
1192057341 X:67786151-67786173 TGTGATATTTAAAGACTGGAAGG - Intergenic
1192489767 X:71565585-71565607 TGTCATATTTAGACACTGGAAGG - Intronic
1193092131 X:77505266-77505288 TCTGATTTTATGATAATGGAGGG + Exonic
1193130778 X:77917458-77917480 ACTGATATTTACAGAGTGGTTGG + Intronic
1193790650 X:85812238-85812260 TATGACATTTACATAGTGCATGG - Intergenic
1194675911 X:96793470-96793492 TCTGTTGTTTAAAAAGTGGAAGG - Intronic
1195491145 X:105471354-105471376 TCTGTGATCTAGATAGTGGGTGG + Intronic
1197282831 X:124557306-124557328 GCAAATATTTAGATATTGGATGG + Intronic
1198836279 X:140808075-140808097 TCTGACATTTGTGTAGTGGAAGG + Intergenic
1200966328 Y:9042371-9042393 TGTTATATTTGTATAGTGGATGG - Intergenic
1202088534 Y:21164052-21164074 TCTCATATTAAAATATTGGAAGG - Intergenic