ID: 967350354

View in Genome Browser
Species Human (GRCh38)
Location 3:188507759-188507781
Sequence AGGTTTCAGCCTTTTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967350354 Original CRISPR AGGTTTCAGCCTTTTCCAGG GGG (reversed) Intronic
900726735 1:4221276-4221298 AGTTTTTAGCCATTTCCAGGAGG + Intergenic
902236224 1:15059300-15059322 AGGTCTCAGCCTGTCCCAGGAGG - Intronic
902328776 1:15720167-15720189 AGGTTAGACCCTTTTCCAGAAGG + Intronic
903065661 1:20697883-20697905 AGGTGACAGCTTTTTCCAGGAGG + Intronic
904804612 1:33121932-33121954 GGGTGTCTCCCTTTTCCAGGTGG + Intergenic
915906947 1:159885847-159885869 AGGAGACAGCATTTTCCAGGAGG + Intronic
917154514 1:171982464-171982486 AGGTTGAATTCTTTTCCAGGAGG + Intronic
917185569 1:172351007-172351029 GGGTTGCAGACTTTCCCAGGAGG - Intronic
917915347 1:179695390-179695412 AATTTTCAGCCTTTTCAAGCTGG - Intergenic
918144013 1:181740104-181740126 CAGCTTCAGCCTCTTCCAGGAGG + Intronic
918464985 1:184811978-184812000 AGGTTTCTCCCTTTTCCGGGAGG - Intronic
919724282 1:200872241-200872263 AGGTTTCACCCCTTTCCAGCAGG + Intergenic
920455947 1:206101248-206101270 AGTTTTCAGCGTTTTACAGCAGG - Intronic
920681098 1:208073375-208073397 AGTTTCCAGCCTCTTCCAGGTGG + Intronic
923854307 1:237829300-237829322 GGCTGTCAGCATTTTCCAGGTGG + Intronic
1063700482 10:8379838-8379860 GGGCTTCAGCTTTTTGCAGGTGG - Intergenic
1063710260 10:8470355-8470377 AGGTTTCAGGTTGTTGCAGGGGG - Intergenic
1064513955 10:16125759-16125781 AGGTTTCAGCATCTTCAAGTGGG + Intergenic
1066152890 10:32642538-32642560 GGGTGGCACCCTTTTCCAGGTGG - Intronic
1066370440 10:34814908-34814930 AGTTTTCAGCCTCATCCAGCAGG - Exonic
1066451269 10:35532561-35532583 AGCTTTCAGCATATTCTAGGAGG - Intronic
1068303836 10:55178487-55178509 AGGTTTAATCCTTTCCTAGGTGG - Intronic
1069723656 10:70564465-70564487 AGGAGTCGGCCTTCTCCAGGTGG - Exonic
1073150794 10:101310291-101310313 AGGTTTCATCCTTTCCCATGCGG - Intergenic
1073783498 10:106864580-106864602 TGGATTCAGCCTTTTCCTGAGGG - Intronic
1073899442 10:108203324-108203346 ACGTTTCAGCCATTTCAACGTGG + Intergenic
1074989879 10:118695082-118695104 TTGTTACAGCCTTTTCCAAGAGG - Intronic
1075861737 10:125683128-125683150 ACTTCTCAGCCTCTTCCAGGAGG + Exonic
1076140803 10:128077456-128077478 AGGTTTCAGCCTTCTCCTTCAGG + Intronic
1076582144 10:131518837-131518859 TGGTTTCAGCCTGTTCCTTGGGG - Intergenic
1076769097 10:132653339-132653361 GGCTTTCAGGGTTTTCCAGGTGG + Intronic
1078346788 11:10556857-10556879 AGGTTTGTGCCGTATCCAGGAGG - Intergenic
1078527847 11:12113791-12113813 AGGTTTCAGGCATTTACTGGGGG + Intronic
1078588924 11:12620871-12620893 AAGTTTCAGTTTTCTCCAGGTGG + Intergenic
1078880938 11:15448249-15448271 AGGTTTCAGCCATCCCCCGGGGG + Intergenic
1079224663 11:18595161-18595183 ATGTTTCAGCCTGTGCTAGGAGG - Intergenic
1079291118 11:19188515-19188537 AGCTTCCACCCTTTTCCAGCTGG - Intronic
1080399364 11:31919963-31919985 AGTTTTCAGCCTCTTCCCTGGGG + Intronic
1085911748 11:80834990-80835012 AGGTTTCATCCATGTCCAGCAGG + Intergenic
1086002350 11:81998450-81998472 AGGTTTTATCCTTACCCAGGTGG + Intergenic
1086044900 11:82521285-82521307 ATGTTTCAGGTATTTCCAGGAGG - Intergenic
1087967504 11:104435984-104436006 TGCTTTCAGCCTTCTCCAAGAGG - Intergenic
1088129035 11:106465164-106465186 GGGTTTCAGCATTTTCCTGACGG + Intergenic
1090619855 11:128550665-128550687 AGGTTCCAGCCTTTCACAGAAGG - Intronic
1091879265 12:3963553-3963575 AGGTTTCAGACTTTTCTTAGAGG - Intergenic
1092299202 12:7229136-7229158 TGGTCTCAGTGTTTTCCAGGTGG + Intergenic
1092737053 12:11592642-11592664 AGGTTCCCGCCATTTGCAGGTGG - Intergenic
1094097857 12:26728093-26728115 AGAGTTCAGCGTTTTCCATGGGG - Intronic
1100699178 12:97128261-97128283 AGGTTTCTGCTTTATCCAGAGGG + Intergenic
1103362868 12:120363898-120363920 CGGTTTCCTCCTTTGCCAGGTGG - Intronic
1103517302 12:121515671-121515693 GGGTTTGGGCCTTTTCCAGACGG - Intronic
1104396427 12:128437567-128437589 ATGTCTCTGCCTTTTCAAGGAGG + Intronic
1105570240 13:21595774-21595796 GGGATTGAGCCTTTTCCAAGAGG - Intronic
1106983748 13:35321184-35321206 AATTTTCAGCCTTTTTCAGCTGG + Intronic
1119484562 14:74979348-74979370 AGCTTTCAGCCTCTTCCCTGGGG + Intergenic
1121569495 14:94936809-94936831 AGGTTCCTGCCTATTCCCGGAGG - Intergenic
1121815862 14:96928198-96928220 AGATTTCAGCATTTTCCAAATGG + Intronic
1121938513 14:98044362-98044384 AAGTTTGAGCTTTATCCAGGTGG + Intergenic
1122451683 14:101813660-101813682 CAGTTTGAGCCTTTTCCAGCTGG + Intronic
1124190637 15:27573807-27573829 AGGTCTCAGCCTTCTCTGGGAGG + Intergenic
1128308139 15:66613567-66613589 AGACTTCATCCTTTTCCAAGTGG + Intronic
1128866963 15:71121297-71121319 AGTTTTGAGCATTTTCCAGGTGG - Intronic
1129754843 15:78091878-78091900 CGGGGTCAGCCTTGTCCAGGAGG - Intronic
1130098191 15:80871747-80871769 AGGGTTCTGGCTTTTCCATGAGG + Intronic
1131061719 15:89408593-89408615 AGGTTTCAGAGTTCTCCAAGTGG + Intergenic
1133461963 16:5994483-5994505 AAGTTTCAGATTTTTCCAAGTGG + Intergenic
1133476683 16:6128959-6128981 AGGTTTTATCCTTTGTCAGGTGG - Intronic
1133602403 16:7352213-7352235 ATTTTTCAGCCTTTCCCAAGAGG + Intronic
1137485466 16:48887086-48887108 TGGTTTAAGCCTTTTCCAAAAGG - Intergenic
1139465753 16:67153211-67153233 AAGTTTCTGCCTTTGCCAGTTGG - Intergenic
1141694337 16:85612659-85612681 AGTATTCAGCCTTTTCTAGTTGG + Intronic
1141712958 16:85710575-85710597 AGTTGTCAGCCTTTACCATGTGG + Intronic
1145722028 17:27082591-27082613 GGGTTGCAGCCTATTCCATGAGG + Intergenic
1146599981 17:34205736-34205758 AGGTTTCAGCAATTGCCATGTGG + Intergenic
1148326443 17:46785971-46785993 AGGTTTCAACATTTTTCAGGCGG - Intronic
1155671566 18:28378024-28378046 AGGCTTCAGCCTATTCCATGGGG - Intergenic
1156350321 18:36297326-36297348 AGGCTTAAGCCTTCTCCGGGTGG + Intergenic
1158102344 18:53843217-53843239 AAGTTTCTGCCATTTCCAGAAGG - Intergenic
1160146697 18:76371350-76371372 AGATTTCAGCCCCTACCAGGCGG - Intronic
1164283563 19:23790440-23790462 AAGTTGCAGCCTTTTCAGGGAGG - Intronic
1164484339 19:28641849-28641871 AAGTTTCACTCTTTTCCATGAGG + Intergenic
1165820937 19:38675696-38675718 AGGTTTCAGCCTCTACCACAAGG + Intronic
1167635180 19:50650021-50650043 AGGTCTCATCCTCTTCCATGTGG + Intronic
1168466205 19:56603849-56603871 TGGTTTCAGCGTTTTCCCTGTGG + Intronic
926572333 2:14543491-14543513 ATTTTTCAGCCTTGTCCAGGAGG - Intergenic
926757570 2:16248695-16248717 GGCTTTCAGCCTCTCCCAGGAGG + Intergenic
928447541 2:31346808-31346830 GGGTTCCAGCCTTTTCAAGATGG + Exonic
931886594 2:66625081-66625103 AATTTTCAGCCTTTTCGAGCTGG + Intergenic
932694253 2:73941134-73941156 AGGAAGCAGCCTTTTCAAGGGGG + Intronic
933254124 2:80060982-80061004 AGGCTTCAGGCCATTCCAGGGGG - Intronic
933391545 2:81675074-81675096 AGGTCTCAGCCTATTTCATGAGG + Intergenic
934186463 2:89681669-89681691 AGGCTTCAGTTTTTTCCAGTGGG - Intergenic
934196977 2:89845615-89845637 AAGTATCAGCCTTGTCCAGATGG + Intergenic
934315554 2:91915561-91915583 AGGCTTCAGTTTTTTCCAGTGGG + Intergenic
935386474 2:102504707-102504729 AGTTTTGATCATTTTCCAGGTGG - Intronic
936014437 2:108947129-108947151 AGGTTTCAGACTTTTGCATGGGG - Intronic
936617561 2:114063536-114063558 AGGTCTCACCCTATTCAAGGTGG + Intergenic
937650999 2:124319001-124319023 AGTTTTTAGCCTTTTCCACTGGG + Intronic
938291066 2:130150784-130150806 GGGTTCCAGCCACTTCCAGGTGG - Intergenic
939517854 2:143191308-143191330 AGTTGCAAGCCTTTTCCAGGTGG - Intronic
943671435 2:190665881-190665903 AGGTTTCAGCTTTATGGAGGAGG + Intronic
945321729 2:208432282-208432304 AAGTTTCTGCCTTTTCCCTGTGG + Intronic
945681467 2:212918971-212918993 TGGTTTAAGCCTTTGCCAGGAGG + Intergenic
945693318 2:213069762-213069784 AGGTTTCAGCTTGTCCCAGGAGG - Intronic
946321021 2:218954618-218954640 AGGGTTCAGCCGCTTTCAGGAGG + Intergenic
946859807 2:223990031-223990053 AGGTTTCAGCTTCTGCCAGGGGG - Intronic
947136259 2:226979451-226979473 AAGTTCCAGCCATTTGCAGGGGG - Intronic
1169745029 20:8934970-8934992 AAGTTCCAGCCTTTCCCAAGGGG - Intronic
1169820433 20:9703825-9703847 AAGTATCAGCCCTCTCCAGGGGG - Intronic
1170207527 20:13814697-13814719 AAGTTTCAGTTTTTCCCAGGTGG + Intronic
1172881548 20:38203076-38203098 AGGGAGAAGCCTTTTCCAGGAGG + Intergenic
1173286614 20:41677528-41677550 AGGTTTCTGGATTATCCAGGTGG - Intergenic
1174170218 20:48613020-48613042 AGATATCAGCCTATTGCAGGGGG - Intergenic
1176102075 20:63368889-63368911 ACGTTGCTGCCTTTTCCAGCTGG - Intronic
1179951471 21:44711105-44711127 AGGTGTCAGCCTTTCCCGGGAGG + Intronic
1180542324 22:16461446-16461468 AGGCTTCAGTTTTTTCCAGTGGG + Intergenic
1181734343 22:24870102-24870124 GGGTTCCAGCCTTGTCCAGGAGG - Intronic
1181752229 22:24996799-24996821 CAGTTACACCCTTTTCCAGGAGG - Intronic
1183649190 22:39144618-39144640 GAGATTCAGCCTTTTCCGGGGGG - Intronic
949190831 3:1246702-1246724 AAATTTTAGCCTTTTGCAGGGGG + Intronic
950391841 3:12702929-12702951 AGATTTAAGCATTTGCCAGGTGG + Intergenic
950561866 3:13735493-13735515 AATTTTCAGCCTTTTCGTGGTGG + Intergenic
950639786 3:14341355-14341377 AGGATACAGCCTTTTCTGGGAGG - Intergenic
951235953 3:20236560-20236582 AGCTTTCAGACTTTTTTAGGGGG - Intergenic
954297125 3:49680522-49680544 TGGCATCTGCCTTTTCCAGGAGG + Exonic
956157220 3:66311582-66311604 AGTTTTCAGCCTTTTTTTGGTGG + Intronic
956641785 3:71422571-71422593 AGTTTTCAGCCTTGTTCAGGTGG - Intronic
957890185 3:86346584-86346606 AGTTTTCTGCCTTTTCAAGCAGG - Intergenic
961412505 3:126732968-126732990 TGGTTTCAGCATTTCCCTGGTGG + Intronic
962237261 3:133717266-133717288 AGGTATCAGCCCTTTCAAGGAGG - Intergenic
966234965 3:177690545-177690567 ACATTTCAGTGTTTTCCAGGTGG + Intergenic
966560460 3:181314276-181314298 AGGTTTGAGCCTTTTGCTGCAGG + Intergenic
966560703 3:181317086-181317108 AGCTTTCAGCTTTTTCCAGATGG + Intergenic
967350354 3:188507759-188507781 AGGTTTCAGCCTTTTCCAGGGGG - Intronic
968327842 3:197836039-197836061 AGATTTCAGAATTTTGCAGGAGG + Intronic
968390517 4:188522-188544 TGGATTCAGCCTCTTCCTGGAGG + Intergenic
968972745 4:3804371-3804393 AGGTTTCAGAGGGTTCCAGGAGG - Intergenic
969616588 4:8256463-8256485 AGGTTTCTTCTTTCTCCAGGAGG - Intergenic
970634331 4:17990702-17990724 AGGTCTCAGCCTTCTGCTGGTGG + Intronic
971039966 4:22741152-22741174 ATCTTTCTACCTTTTCCAGGTGG - Intergenic
972519150 4:39837326-39837348 AGATTTCAGACTTTTCCTGTTGG - Intronic
976481518 4:85552130-85552152 ATCTTTCAGACTTTTCCATGTGG + Intronic
976522063 4:86039808-86039830 AGGTTTCAGGCCTATCCATGGGG + Intronic
978491890 4:109318640-109318662 AGGTTTTATCCTTTCCCAGGTGG - Intergenic
980496327 4:133590556-133590578 AGGTTTCACCCTTACCTAGGTGG - Intergenic
981652569 4:147076429-147076451 AAGTTTGAGCCTTTTGCAGCAGG + Intergenic
982530156 4:156530845-156530867 AGGTGTCAGCCTGTGGCAGGGGG + Intergenic
983846603 4:172527788-172527810 GAGTTTCAGGCTTTTCCATGAGG + Intronic
987754375 5:22081990-22082012 TGGTTTCAGGCATTTCCTGGGGG - Intronic
988297603 5:29386071-29386093 AGTTTTCAGCCATTTACTGGAGG + Intergenic
988913686 5:35871183-35871205 TGTTTTCATCCTTTTCCTGGCGG - Exonic
989080368 5:37613434-37613456 AGGTTTCAGCTTTCTCTAGGTGG - Intronic
989552129 5:42748070-42748092 AAGTTTCAGTTTTTTCCAGGTGG + Intergenic
989986039 5:50699076-50699098 AGGTTTTAACCTTTTCCAAGTGG - Intronic
991474447 5:67004415-67004437 AAGTTTCCGCTTTTTTCAGGAGG + Intronic
992484174 5:77180017-77180039 ATCTTTCAGCGTTTTCCTGGGGG + Intergenic
996522154 5:124439005-124439027 GGGTTTCATCGTTTTCCTGGTGG + Intergenic
996828812 5:127716838-127716860 AGGCTTCAGCCAATTCCAAGGGG - Intergenic
999587911 5:153111069-153111091 AGGATTCAACCTTGTCCAGAGGG + Intergenic
1000698453 5:164418719-164418741 AGGCTCCAGCCAGTTCCAGGTGG - Intergenic
1001915243 5:175555002-175555024 AAGTTTGTGCCGTTTCCAGGGGG - Intergenic
1003301341 6:4885491-4885513 AGGTTTCAGGCATTGGCAGGGGG + Intronic
1004463229 6:15858459-15858481 AGGTTTCATCCTCTTCCAGAGGG + Intergenic
1004719952 6:18260520-18260542 AGGTTTCTGTCTTTGGCAGGTGG - Intronic
1007373087 6:41439623-41439645 AGGGTTCAGCCTGGGCCAGGAGG - Intergenic
1009858496 6:69293943-69293965 AGAGTTCCTCCTTTTCCAGGGGG + Intronic
1011040018 6:83019752-83019774 TGGTTTCAGCCTGATCCATGGGG + Intronic
1012916465 6:105176371-105176393 AGGTTTCAGCCAATCACAGGCGG - Intronic
1013792159 6:113849821-113849843 AGTTTTCAGCCTGTCCCTGGAGG + Intergenic
1013997455 6:116325072-116325094 TGGTTCCAGCCTTTCCAAGGAGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014387065 6:120816038-120816060 AGGCTTGAGCTTTTTGCAGGAGG - Intergenic
1015782278 6:136881211-136881233 AGGTTTCCTCCTGTTCCTGGTGG - Intronic
1015987463 6:138898817-138898839 AGGTTTCAGCCATCTACTGGGGG - Intronic
1016312936 6:142753835-142753857 AGGCTCCAGCCTTTTCCCTGAGG - Exonic
1017360613 6:153564856-153564878 AGGTTTCTGCCTTCTCCCAGTGG - Intergenic
1020503011 7:8946938-8946960 AAGTTACAGCCTTTTCTAGAGGG - Intergenic
1021572667 7:22081997-22082019 AGGTTTCTGACTTTTCCAGAAGG - Intergenic
1023596023 7:41830084-41830106 AAGGTTCAGACTTTTACAGGAGG + Intergenic
1027624336 7:80528513-80528535 AGGTTTAGGCCTGTTCCAGTAGG + Intronic
1027841689 7:83320370-83320392 AGATTTCAGAGTTTTCCTGGGGG - Intergenic
1028124449 7:87095996-87096018 AGGTTTCAGCTTTCTACATGTGG + Intergenic
1028778858 7:94712335-94712357 TGATTTCTGCATTTTCCAGGGGG + Intergenic
1028990066 7:97039674-97039696 TGGTTTCTTCCTTTTGCAGGTGG - Intergenic
1032490079 7:132317993-132318015 GGATTACAGCCTTTCCCAGGAGG - Intronic
1033472022 7:141658768-141658790 GGGTTTCTGCCTTTTCTCGGAGG + Exonic
1034380185 7:150685359-150685381 AGGTTTAAGCCCTTCTCAGGGGG + Intergenic
1040071607 8:43193093-43193115 AGGGATCAGCCTTCTGCAGGGGG - Intronic
1041459615 8:58097638-58097660 AATTTTCAGCCTTTTTCAGCTGG + Intronic
1046865279 8:119142410-119142432 CAGTTTCAGCCTTTTGCATGTGG - Intergenic
1052849743 9:33370357-33370379 ATGTTTCAGGCATTTTCAGGAGG - Exonic
1055986626 9:82060815-82060837 AAGTTTCTGCCTTCTCCTGGTGG - Intergenic
1057160546 9:92885400-92885422 AAGTTTCTGCCTTCTCCTGGTGG + Intergenic
1057967720 9:99520255-99520277 AGGTTTCAGGGTTCTCCAGCAGG - Intergenic
1058435652 9:104960845-104960867 GGGTCGAAGCCTTTTCCAGGAGG - Intergenic
1186202828 X:7171305-7171327 AGGACTCAGCGTTTTCCAGGAGG + Intergenic
1188084257 X:25883388-25883410 AGTTTTCAGCCTTTTTGCGGCGG - Intergenic
1188103264 X:26116967-26116989 TGGTTTCAGCCTATTTCAGGTGG + Intergenic
1192175762 X:68884291-68884313 AGGCCTGAGACTTTTCCAGGAGG - Intergenic
1195355964 X:104040195-104040217 GGGCCTCAGCCTTTCCCAGGAGG + Exonic
1196908776 X:120465270-120465292 AGGTTTGAGGCTTTTCTGGGTGG - Intronic
1198377726 X:136055644-136055666 AGTTTTTAGCATTTTCCAGAAGG + Intergenic
1200258304 X:154597610-154597632 AAGTTTGTGCCATTTCCAGGCGG + Intergenic
1201964958 Y:19722322-19722344 AAGTTTCATCCTTTTGCATGTGG - Intronic