ID: 967350635

View in Genome Browser
Species Human (GRCh38)
Location 3:188510565-188510587
Sequence GCCCACTCTCTCCTTCGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967350627_967350635 28 Left 967350627 3:188510514-188510536 CCATGTGTTTGTTCCCACATCAA 0: 1
1: 0
2: 0
3: 17
4: 242
Right 967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG 0: 1
1: 0
2: 0
3: 13
4: 151
967350630_967350635 -3 Left 967350630 3:188510545-188510567 CCCAAGATACAATTACCCCTGCC 0: 1
1: 0
2: 0
3: 23
4: 319
Right 967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG 0: 1
1: 0
2: 0
3: 13
4: 151
967350631_967350635 -4 Left 967350631 3:188510546-188510568 CCAAGATACAATTACCCCTGCCC 0: 1
1: 0
2: 0
3: 18
4: 141
Right 967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG 0: 1
1: 0
2: 0
3: 13
4: 151
967350629_967350635 14 Left 967350629 3:188510528-188510550 CCACATCAACACTAAGTCCCAAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG 0: 1
1: 0
2: 0
3: 13
4: 151
967350628_967350635 15 Left 967350628 3:188510527-188510549 CCCACATCAACACTAAGTCCCAA 0: 1
1: 0
2: 2
3: 20
4: 168
Right 967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967350635 Original CRISPR GCCCACTCTCTCCTTCGTCA TGG Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
914678053 1:149918731-149918753 TCCCTCTCACTCCTTCGGCAGGG - Intergenic
914782408 1:150797713-150797735 CCCCACTCTCCCCTTCTCCAGGG + Intronic
915243728 1:154541854-154541876 GTCCACTCTCTCCATCCTCACGG - Intronic
918480861 1:184975027-184975049 CCCCACTCCCTCCTTGGTCCAGG - Intergenic
921507676 1:215992647-215992669 TCCACCTCTCTCCTTCGCCAAGG + Intronic
921514709 1:216075616-216075638 CCCCACTCTCTCCCTCTCCATGG + Intronic
922241744 1:223759951-223759973 GCTCTCTCTCCCCTTCCTCATGG + Intronic
924722971 1:246639927-246639949 GGCCAATCTCTCCATCCTCAGGG + Intronic
924827636 1:247557655-247557677 GCCAACTCTCTCCTTTGTGCAGG - Intronic
1062954436 10:1530711-1530733 GCCCACACTCTCCCTGCTCACGG + Intronic
1063948596 10:11201620-11201642 GTCCATCCTCTCCTTCCTCAGGG - Intronic
1064507436 10:16048347-16048369 GCCCACTCTCTGCCTAATCATGG + Intergenic
1065274190 10:24068800-24068822 CCCAACTCTTTCCTTCCTCAGGG + Intronic
1066289178 10:33998433-33998455 GCACACTCTCTGCTTCGGCTGGG + Intergenic
1067580826 10:47444372-47444394 GCCCTCCCTCTCCTTGGTCCTGG - Intergenic
1069798380 10:71067582-71067604 GCCCGCTCCCACCTTCCTCAGGG + Intergenic
1073374487 10:103021244-103021266 CCACTCTGTCTCCTTCGTCAGGG - Intronic
1074112309 10:110431196-110431218 GCCCCAGCTCTCCTTCCTCAGGG - Intergenic
1075045132 10:119140588-119140610 GGCCTCTCTCTGCTTCCTCAGGG - Intergenic
1075584543 10:123647951-123647973 GCCCCCTCTCACCATCCTCAGGG - Intergenic
1076298601 10:129406564-129406586 TCCCGCTCTGTCCTTCGTGAAGG - Intergenic
1079166598 11:18049885-18049907 GCCATCTCTCTTCTTCATCAGGG - Intergenic
1084116497 11:67045736-67045758 GCCCACAGACCCCTTCGTCAAGG + Exonic
1084669510 11:70596733-70596755 GTCCACTCTCTCCGGGGTCACGG + Intronic
1090163216 11:124517451-124517473 GCCGACTCTCTCCTTAGTCTCGG - Intergenic
1090670738 11:128943410-128943432 CCGCACTCTGTCCTTCCTCAAGG + Intergenic
1090936528 11:131347860-131347882 GCCAACTCTCTCCTTGACCAGGG + Intergenic
1090973642 11:131663700-131663722 TCCCACTCTCTCTTTGGACAAGG + Intronic
1091162134 11:133433723-133433745 TCCCACTCTCTCCTTCTGCAAGG + Intronic
1091394603 12:146263-146285 GCCTGCTCTCCCCTTCCTCATGG - Intronic
1091889929 12:4045261-4045283 GCTCTCTCTGTCCTTTGTCAGGG + Intergenic
1092359332 12:7822946-7822968 GCCCAATCTCTGCTTATTCAAGG - Intronic
1101906161 12:108828095-108828117 TTCCATTCTCTCCTGCGTCATGG - Intronic
1103037326 12:117667123-117667145 GCCCTCTCTCTCCCTCTTCCCGG - Intronic
1105617304 13:22030437-22030459 GACCATTCCCTCCTTCCTCATGG - Intergenic
1106593931 13:31121193-31121215 GCCCACTCTTTCCTACCTCCTGG - Intergenic
1108474772 13:50803241-50803263 ACTCACTCTCCCCTTCCTCATGG + Intronic
1108732876 13:53253269-53253291 GCCCCCTTCCTCCTTCCTCATGG - Intergenic
1113074871 13:106458417-106458439 GACCACACTCTCCTTCTCCATGG + Intergenic
1113863828 13:113508555-113508577 GCCCCCTCTCTCCTTCCACAAGG - Intronic
1114449434 14:22815310-22815332 GCACACTCACTCCTTGGTCCTGG + Exonic
1115993876 14:39175589-39175611 GGCCTCGCTCTCCTTCCTCAGGG - Intronic
1117551569 14:56842199-56842221 GCCCACTTTCTCTTTTTTCATGG - Intergenic
1117969674 14:61239496-61239518 GGCCTCTCTCTCCCTCTTCAGGG + Intronic
1118991469 14:70800826-70800848 GCCCAACCTCTGCTTGGTCATGG - Exonic
1120697967 14:87665467-87665489 GCCCCCTTTCTCCATCTTCAAGG - Intergenic
1121846375 14:97175788-97175810 GCCCACTCTCACCTTTCTGATGG - Intergenic
1122091438 14:99343495-99343517 CCCCACTCTCACCTTCTTGAGGG - Intergenic
1122161943 14:99791420-99791442 TCCTTCTCTCTCCTTTGTCAAGG + Intronic
1123145685 14:106127961-106127983 GCCCAAGGTCTCCTTCCTCAAGG + Intergenic
1125200451 15:37097603-37097625 GGAAACTTTCTCCTTCGTCAAGG + Intronic
1125642590 15:41243710-41243732 TCCCATTCTCTCCTTTGTCCAGG - Exonic
1129539625 15:76339647-76339669 GGCCCCTGTCTCCTTCCTCAAGG - Intronic
1129913483 15:79247313-79247335 GCACACACTCTCCTTCTTCCTGG + Intergenic
1134073060 16:11272527-11272549 GCTCACTCCCGCCTTCTTCAAGG - Intronic
1136024195 16:27459464-27459486 GCCCACACTCTCCATCATCTGGG + Intergenic
1139474155 16:67194280-67194302 GCCCACTGTCTAGTTCCTCAGGG + Intronic
1141294078 16:82750409-82750431 ACCCACTCTCTCCTTCTTTAGGG + Intronic
1141392484 16:83676377-83676399 GCCCACCCTCAGCGTCGTCATGG + Intronic
1141848281 16:86626264-86626286 CCCCACTCTCTCTGTCCTCAAGG - Intergenic
1144673404 17:17145822-17145844 GCCCAGCATCTCCTTCCTCAAGG + Intronic
1144782467 17:17814943-17814965 GCCAGCTCTCTCCTTCCACAGGG - Exonic
1147958700 17:44152964-44152986 ACCCACTCTCTCCTTCCACCTGG - Intronic
1149998289 17:61416421-61416443 GCCCACTAGCTCCTTCTCCAGGG + Intergenic
1151819916 17:76491809-76491831 ACCCACTCTGGCCTTCCTCATGG + Intronic
1153818631 18:8813040-8813062 CACCTCTCTCTCCTTCTTCAAGG - Exonic
1155404032 18:25468082-25468104 CCCCTCTCTCTCCTTCTTCCAGG - Intergenic
1160510480 18:79450814-79450836 GGCCACTCTCCCCTTCCCCAAGG - Intronic
1160916964 19:1501389-1501411 GCACCCTCTCTCCTCCCTCAGGG - Intergenic
1166209827 19:41299233-41299255 GCCCACATCCTCCTTCGTGAGGG + Intronic
1167509380 19:49888153-49888175 GCCCACTCTGTGCTTCGTGCTGG - Intronic
1168335715 19:55596491-55596513 GCACACTCCTTCCTTCCTCAGGG + Intronic
1168392650 19:56023122-56023144 TCCCATCCTCTCCTTCGTGAGGG - Intronic
927646928 2:24883433-24883455 GCCCAAGCTTTCCTTCCTCATGG - Intronic
927957643 2:27218888-27218910 GCTCACTCTCCCCAGCGTCAGGG - Intronic
928102767 2:28449158-28449180 CCTCAATCTCTCCATCGTCAGGG + Intergenic
930586951 2:53278381-53278403 GCCCTCTCTTTCCTCCATCATGG + Intergenic
936012921 2:108936520-108936542 TCCCACGCTCTCCTTCCTCCAGG + Intronic
937285171 2:120746120-120746142 GCCATCTCTCTCCGTCTTCAAGG + Intronic
938579106 2:132630379-132630401 GCCAACTCACTCCTGCCTCAGGG - Intronic
946894545 2:224310018-224310040 GCTCCCTCCCTCCTTCCTCACGG + Intergenic
947724389 2:232388116-232388138 GCCCACCCGCTCCTTCCCCAGGG + Intergenic
1169347486 20:4839972-4839994 GCCCACTCTCCCCATGGCCATGG - Intergenic
1172240246 20:33408317-33408339 GTCCACTCTGTCCTGCGTCTGGG + Exonic
1172453608 20:35048033-35048055 GCCCACTCTCTCCCTCACTATGG + Intronic
1172519368 20:35557172-35557194 GCCCACCCTCTCCTTCTACCAGG + Exonic
1175815174 20:61879724-61879746 GCCCACTCTCACCTTCAGGACGG - Intronic
1176255109 20:64147656-64147678 ACCCACTATCTCCTTCCCCAGGG - Intergenic
1182466114 22:30517513-30517535 GCCCCTTCTCTCCTCCGACATGG + Intergenic
1184450476 22:44579598-44579620 ACCCACTCTCCCATTCTTCAGGG - Intergenic
1185178387 22:49344895-49344917 GCACCCTCTCTCCTTCCTCCAGG - Intergenic
950377178 3:12581369-12581391 GCCAACTCTCCCCTTCCTCCTGG - Intronic
953871075 3:46628051-46628073 GCTCACTATCTCCTTGGCCATGG - Intergenic
961295834 3:125883668-125883690 GGCCTCTCTCTCCTTCCCCAAGG + Intergenic
962149420 3:132877207-132877229 TCCCACTTTCTGCTTCATCAAGG + Intergenic
962881923 3:139586512-139586534 GCCCAGGCTCTCCTTCCTGAGGG + Intronic
965296650 3:166955639-166955661 GCTCAGCCTCTCCTTGGTCAGGG + Intergenic
967350635 3:188510565-188510587 GCCCACTCTCTCCTTCGTCATGG + Intronic
969124767 4:4938715-4938737 CCCTACTCCCTACTTCGTCAGGG - Intergenic
969527932 4:7713497-7713519 GCCCAATCTCTCCTTTGAGAGGG - Intronic
970338193 4:15075072-15075094 GCCAATTCTTTCCTTCCTCAGGG - Intergenic
977081976 4:92541741-92541763 GCCCACTCTCACCCTCTACATGG - Intronic
979024629 4:115553382-115553404 GCCTTCTGTCTCCTTCTTCAGGG + Intergenic
979469500 4:121077820-121077842 CCGCACTCTCACCTTGGTCATGG - Intergenic
979743652 4:124181779-124181801 GCCTACTCACACCTTCTTCATGG - Intergenic
989192622 5:38686072-38686094 TACCACTCTCTCCTTCGTGTTGG + Intergenic
992198786 5:74364310-74364332 GCTCACTCTCTCCCTCCTCATGG - Intergenic
992942171 5:81773303-81773325 GCCCACTCTCCCCATCTCCAGGG + Intergenic
995796455 5:115946300-115946322 GCCCACTCTCTGCTCTTTCAGGG + Intergenic
997677255 5:135721984-135722006 GCCCCCTCTCTGCTTCCCCAAGG + Intergenic
1002299125 5:178247677-178247699 GCCCGCTCTCTCCTGGGTCATGG + Intronic
1003121500 6:3322384-3322406 GCCCACTCCATCCTTCTCCAGGG + Intronic
1003495794 6:6662136-6662158 CCCCACTCTCCCCTTGGTCAGGG + Intergenic
1005259466 6:24042668-24042690 GCTCAGACTCTCCTTGGTCAGGG + Intergenic
1005637336 6:27764828-27764850 CCCCAATCTCTCCTTCCCCATGG + Intergenic
1005894673 6:30167804-30167826 CCACACTCTCTCCTTGGTCAAGG - Intronic
1006947638 6:37795749-37795771 CCCCACTCTTTCCTTCTCCAGGG - Intergenic
1008981250 6:57486445-57486467 GCCCATTCTTTACTTTGTCATGG - Intronic
1009169345 6:60379469-60379491 GCCCATTCTTTACTTTGTCATGG - Intergenic
1012570993 6:100728758-100728780 TCCCACTCTCTCCTTTGCCAAGG + Intronic
1014944003 6:127475625-127475647 GCCCACTCGCTCCTTCTACCCGG - Exonic
1019944951 7:4320107-4320129 GCCCAATCTCTTCATCGTAATGG - Intergenic
1022244532 7:28545776-28545798 GCCCATTCTCTTCTTCTGCATGG + Intronic
1028569627 7:92272396-92272418 TTCTACTCTCTCCTTCGACAAGG - Intronic
1031837238 7:126692165-126692187 GCCCACTCACTTCTGTGTCAAGG - Intronic
1032448910 7:132009878-132009900 GCTCACACTCTCCTTGGGCAGGG + Intergenic
1033506875 7:142012374-142012396 GCCCACTGTCTCCTTTATAAGGG + Intronic
1034317238 7:150143868-150143890 GCCCACTCTCACCTTCCACAGGG - Intergenic
1034775514 7:153823349-153823371 GCCCACTCTCACCTTCCACAGGG + Intergenic
1035015566 7:155762817-155762839 GCCCACTCTCAACATCGACAGGG - Intronic
1035329575 7:158087582-158087604 GAAGACTCCCTCCTTCGTCAGGG - Intronic
1037991339 8:23323369-23323391 GCCCACGCTCTCCTCCCTCTAGG + Intronic
1038157304 8:25001878-25001900 GCCCACGCTCTCTTTCCTCCCGG - Intergenic
1038331552 8:26613377-26613399 GCCCACTGCTTCCTTCCTCATGG - Intronic
1039116069 8:34092425-34092447 CCTCATTCTCTCCTTTGTCAAGG + Intergenic
1039440935 8:37595003-37595025 GCCCACTCCCTCCTTCACCCGGG + Intergenic
1041316114 8:56564367-56564389 CCCCACTCTCTCTTCTGTCAAGG - Intergenic
1045244890 8:100434278-100434300 GCCACCTCTCTCCTTTGTCTCGG + Intergenic
1046172743 8:110532399-110532421 GCCCATTTTCTCCTTCTGCAGGG + Intergenic
1047729781 8:127717647-127717669 GTCCACTCTCTCACTCATCAAGG - Intergenic
1048822950 8:138396488-138396510 GCTCACTCTGTCCTTCCTCCTGG + Intronic
1049700593 8:144009867-144009889 GCCCACTCTCTCCACCTCCATGG + Intronic
1050005897 9:1129934-1129956 ACACACTCTCTCTTTCATCACGG - Intergenic
1051981376 9:23023634-23023656 GCCCACTCTCGTCTTCTACATGG - Intergenic
1052716283 9:32121599-32121621 GCCCACTCTCTCCAGCATCCAGG + Intergenic
1052854761 9:33400383-33400405 GCCCACTCTCGTCTCCTTCATGG - Intronic
1053682780 9:40496664-40496686 GCCCACTCTCATCTCCTTCATGG - Intergenic
1053932762 9:43125005-43125027 GCCCACTCTCATCTCCTTCATGG - Intergenic
1054280934 9:63128265-63128287 GCCCACTCTCATCTCCTTCATGG + Intergenic
1054295880 9:63332178-63332200 GCCCACTCTCATCTCCTTCATGG - Intergenic
1054393897 9:64636673-64636695 GCCCACTCTCATCTCCTTCATGG - Intergenic
1054428546 9:65141886-65141908 GCCCACTCTCATCTCCTTCATGG - Intergenic
1054501833 9:65879659-65879681 GCCCACTCTCATCTCCTTCATGG + Intronic
1057311402 9:93945456-93945478 GCCAACTCCCTCCTTCCCCAGGG - Intergenic
1058872924 9:109218073-109218095 GACCATGCTCTCCTTCTTCAAGG + Intronic
1062163335 9:135092213-135092235 GCCCACCCTCTCCTTCTCCAAGG - Intronic
1186450110 X:9665198-9665220 GCAGACTTTCTCCTTCCTCAAGG - Intronic
1191604100 X:63042864-63042886 GCCCCTTCTGTCCTTAGTCATGG + Intergenic
1198832720 X:140767831-140767853 GGCCTCTCTCTCCTTTGCCATGG - Intergenic
1199054044 X:143271363-143271385 GCTCACTTTCTCCATCTTCAAGG + Intergenic
1199220886 X:145314556-145314578 GCTCATTCTCTTCTTCCTCATGG + Intergenic
1200001125 X:153060250-153060272 GCCAACTCCCTCCTTCCTGAGGG - Intronic
1200034217 X:153317870-153317892 GCCAACTCCCTCCTTCCTGAGGG + Intergenic
1202038060 Y:20655296-20655318 GCTCACACTCTCCTTGGGCAGGG - Intergenic