ID: 967351748

View in Genome Browser
Species Human (GRCh38)
Location 3:188521341-188521363
Sequence GATGTCTTACAAGCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967351746_967351748 -8 Left 967351746 3:188521326-188521348 CCCTGGAAACTAATTGATGTCTT 0: 1
1: 0
2: 0
3: 16
4: 318
Right 967351748 3:188521341-188521363 GATGTCTTACAAGCACAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 139
967351747_967351748 -9 Left 967351747 3:188521327-188521349 CCTGGAAACTAATTGATGTCTTA 0: 1
1: 0
2: 0
3: 12
4: 136
Right 967351748 3:188521341-188521363 GATGTCTTACAAGCACAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967351748 Original CRISPR GATGTCTTACAAGCACAGAC TGG Intronic
900808498 1:4783723-4783745 TGTGTCATACAAGCATAGACTGG + Exonic
909088838 1:71200672-71200694 GATGTTTTTGAAGCACTGACAGG - Intergenic
912822701 1:112880550-112880572 GATTTCTTGCAAGGACAGATAGG + Intergenic
912868000 1:113276393-113276415 GATGTCTAAAAAGCATAGAAAGG - Intergenic
916292935 1:163186436-163186458 AATATCTTAAAAGCAAAGACAGG + Intronic
917591900 1:176484737-176484759 GATGACATGCAAGAACAGACAGG - Intronic
922858308 1:228794076-228794098 GATGACTTTCAAGACCAGACAGG + Intergenic
924566406 1:245202405-245202427 AATGTTTTCCAAGCTCAGACCGG - Intronic
1063442071 10:6080867-6080889 GGTGTCTTCCAAGGTCAGACTGG - Intergenic
1063487494 10:6433728-6433750 GATGTTTTAGAAGCAAAGAGGGG + Intronic
1065629697 10:27665916-27665938 GATATCTTAGAAGCAGAGAGTGG + Intergenic
1068265591 10:54644312-54644334 AATGTCCTACAATCATAGACTGG + Intronic
1072795763 10:98353335-98353357 GAAGTCTTCCAAGCACAAAGAGG + Intergenic
1073788270 10:106913939-106913961 GAGGACCTACAAGCACAGAAGGG - Intronic
1074922549 10:118031510-118031532 GGTATGATACAAGCACAGACAGG + Intronic
1078301940 11:10140332-10140354 GATGTCTTACAAAGAGGGACTGG + Intronic
1083157287 11:60831771-60831793 GATGTATTACACGCACCAACAGG + Intergenic
1085611189 11:77951112-77951134 GATGTCCAACAATGACAGACTGG - Intronic
1088784145 11:113165434-113165456 CTTGTCTTACAAGCAGAGAATGG + Intronic
1088932847 11:114369461-114369483 GATGTCTGCCAAAAACAGACAGG + Intergenic
1089683322 11:120131593-120131615 CATGTCTTGCAAGACCAGACCGG + Intronic
1089726877 11:120489126-120489148 GATGTCTGACAGTCACTGACAGG - Exonic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1099074475 12:78088839-78088861 CATGTCATACTAGCAAAGACAGG + Intronic
1099788151 12:87294540-87294562 AATGTCTAACAAGGATAGACTGG - Intergenic
1100858463 12:98779000-98779022 GTTGTCATACATTCACAGACTGG + Intronic
1102051222 12:109863462-109863484 GATGTCATACAAGTACCAACTGG - Intronic
1102123275 12:110459858-110459880 GATGTCTGAAAAGGACAGATAGG + Exonic
1104248637 12:127067834-127067856 GATGTCTTACAGGCAAACAGAGG + Intergenic
1110434609 13:75465117-75465139 GAGGACATACAAGTACAGACAGG + Intronic
1110912611 13:80982509-80982531 AATGTCCAACAAGGACAGACTGG - Intergenic
1115325391 14:32131973-32131995 AATGTCCAACAAGGACAGACTGG - Intronic
1116060093 14:39912696-39912718 GATGTCAGACCAGCAAAGACTGG + Intergenic
1117145753 14:52835648-52835670 GTTCTCTTTTAAGCACAGACAGG + Intergenic
1119013734 14:71025980-71026002 GATTTCTGACAATCACAGAAAGG - Intronic
1121799291 14:96760290-96760312 GATATCCTCCAAGCAGAGACGGG - Intergenic
1123925531 15:25106364-25106386 CATGACTGACAAGCACAGCCAGG - Intergenic
1125181382 15:36883868-36883890 CCTGTCTTGCAAGCACAGAGTGG - Intergenic
1127973831 15:63982906-63982928 AATGTCTTACTAGTGCAGACAGG - Intronic
1129636208 15:77321048-77321070 GATGTCCAACAATGACAGACTGG - Intronic
1133929283 16:10218939-10218961 GATGTCTGGCAGCCACAGACTGG + Intergenic
1138449624 16:57085728-57085750 GATGGCTCACATGCAGAGACGGG - Intergenic
1140043239 16:71423474-71423496 GATGTCTCAGATGCACAGTCTGG + Intergenic
1142397549 16:89840946-89840968 CATCTTTTACAAGCACACACAGG + Intronic
1143707397 17:8708345-8708367 GTTGTCTTAGAAACACAGATTGG - Intergenic
1144803072 17:17944514-17944536 GGTGTCTTAGAAGCAAAGAAAGG + Intronic
1145842843 17:28010608-28010630 GTTGTCTTAGAGGCACAGGCTGG + Intergenic
1148506433 17:48131121-48131143 GATGTCTTTCAGCCACAGAGTGG + Intergenic
1149481223 17:57004801-57004823 GATGCCTAACAACCACAGATTGG - Intronic
1150365427 17:64578525-64578547 TATTTCTTACATACACAGACTGG - Exonic
1151223824 17:72633878-72633900 TATGTTTTAAAAGGACAGACTGG + Intergenic
1151997944 17:77622808-77622830 GATGTCTTTCAAGAAGAGAATGG - Intergenic
1152487560 17:80604091-80604113 AATGTCTCTCAAACACAGACGGG + Intronic
1153481456 18:5551352-5551374 TCTGTTTTACTAGCACAGACGGG + Intronic
1153482768 18:5564267-5564289 GATGTCTTACAGGTAAAGATAGG + Intronic
1155624735 18:27821295-27821317 AATGTCCAACAACCACAGACTGG - Intergenic
1158962803 18:62600687-62600709 GATGTAATACAAGCAAAGACTGG - Intergenic
1160474367 18:79168862-79168884 GATTTAATACAAGCACACACTGG - Intronic
1161058594 19:2202797-2202819 CATGTCACACCAGCACAGACCGG - Intronic
1165525172 19:36348465-36348487 GATGTCTTACCAGGACAGTCAGG + Intronic
1166516721 19:43452683-43452705 CATGGCTTACAAGCCCACACAGG - Intergenic
926130551 2:10301353-10301375 GATTTCTCCCAAGCACACACAGG - Intergenic
931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG + Intergenic
936719454 2:115233422-115233444 GAGGTCTTATAATCACACACGGG - Intronic
936772877 2:115936175-115936197 AATGTCCAACAATCACAGACTGG - Intergenic
936922884 2:117707305-117707327 GATGTTTTACCAGCACTGAGAGG - Intergenic
940234757 2:151498148-151498170 GATGTATTAGAAGCAAAGAAGGG + Intronic
940568220 2:155396454-155396476 GTTGTCTCAGAAGCACAGAGCGG - Intergenic
940599763 2:155844448-155844470 GGTGTCTGATAAGCACAGAATGG - Intergenic
941039428 2:160603807-160603829 GATGTCTGTCAGGCAGAGACTGG - Intergenic
942218624 2:173747229-173747251 CATGTCTTCCATGCACACACAGG - Intergenic
942490157 2:176481957-176481979 GATGTTTTAAAAGAACTGACGGG - Intergenic
943452869 2:188066841-188066863 GATGTCTTAGACGCACATTCTGG + Intergenic
946143291 2:217710032-217710054 GAGCTCTTACAAGCAAAAACTGG + Intronic
947174685 2:227352985-227353007 GAAGCCTTACAAACAAAGACAGG - Intronic
1174555077 20:51389116-51389138 GATGTCTTAGAAAAACAGAGGGG + Exonic
1175717206 20:61263128-61263150 GAGGTTTTACAAGAACACACCGG - Intronic
1176372125 21:6068578-6068600 GACGACCTGCAAGCACAGACTGG + Intergenic
1177335038 21:19712645-19712667 GATGTATTGCAAGCATTGACTGG - Intergenic
1179175743 21:39006680-39006702 GATGTCTTTCGACCACAGAAAGG - Intergenic
1179751394 21:43469961-43469983 GACGACCTGCAAGCACAGACTGG - Intergenic
1182096183 22:27627518-27627540 CAGGTCCTACAAGAACAGACAGG + Intergenic
950261939 3:11548799-11548821 GATCTCTTACAGGAAAAGACTGG - Intronic
950319926 3:12041938-12041960 GCTGTCTTAGAAGGACAGGCAGG - Intronic
952426891 3:33184790-33184812 GATGACATACAAGAACAGATGGG - Intronic
957706260 3:83789387-83789409 AAGGTCTTATAAGCAAAGACAGG + Intergenic
958635542 3:96739705-96739727 AATGTCCAACAAGCATAGACTGG + Intergenic
962423067 3:135245118-135245140 GATGTCTTCCCAGCAAAGAAGGG - Intronic
967351748 3:188521341-188521363 GATGTCTTACAAGCACAGACTGG + Intronic
967685480 3:192411033-192411055 TATGATTTCCAAGCACAGACAGG + Intronic
971864865 4:32156480-32156502 AATGTCCAACAAGCATAGACTGG + Intergenic
972708228 4:41566890-41566912 GAAGTCTTTCAAGCCTAGACTGG + Intronic
973116281 4:46464110-46464132 GATGTCTAACAATGATAGACTGG - Intronic
975261964 4:72313520-72313542 GATGTATCAAAAACACAGACTGG + Intronic
976421269 4:84847177-84847199 TATATCTTCCAAGCAGAGACTGG + Intronic
978931456 4:114317972-114317994 TATGTCTTAAAAGGCCAGACTGG - Intergenic
979501867 4:121449606-121449628 AATGTCTAACAAGGACAGATTGG + Intergenic
980643401 4:135609521-135609543 GATATGTTAGAAGCAAAGACAGG + Intergenic
981435213 4:144711889-144711911 GATCTTTTCCAAGCTCAGACTGG - Intronic
982538185 4:156633114-156633136 GATGTCAGACAAGCAAAGAATGG + Intergenic
984174414 4:176398486-176398508 GATATTTTACAATCACAGATTGG - Intergenic
989135948 5:38154843-38154865 GATTTCTCCCAAGCACTGACAGG + Intergenic
992579226 5:78154112-78154134 CATTTCTTACAAGAAAAGACAGG + Intronic
992639835 5:78759754-78759776 AATGTCTTGGAAGCAGAGACTGG - Intronic
999955712 5:156699301-156699323 GATGACTCAGAGGCACAGACAGG - Intronic
1000161998 5:158606877-158606899 TGTGTCTCACAAGCAAAGACGGG - Intergenic
1000613418 5:163400572-163400594 GATGTATTTGAAGCACAGAAAGG + Intergenic
1001882887 5:175259911-175259933 TATGTCATACATGCAAAGACAGG - Intergenic
1002155417 5:177274596-177274618 GATGTTTTACAAGAACAACCTGG - Intronic
1008583905 6:52931578-52931600 ACTGTCTTTCAAGCACATACTGG + Intergenic
1015609252 6:134997702-134997724 GATGTCCTACAATGACAGAAGGG + Intronic
1016597482 6:145817573-145817595 GCTATCTTAGAAGCACAGATGGG - Intergenic
1016741535 6:147533953-147533975 GATGTCTTACAAAAATAAACTGG + Intronic
1016866076 6:148768248-148768270 CATGTCTTACAAGCATAAACTGG - Intronic
1019054369 6:169213062-169213084 GCTGTCATTCAAGCACAGTCAGG + Intergenic
1020577252 7:9948766-9948788 GATGGCTTTCATGCAAAGACAGG + Intergenic
1021190212 7:17611651-17611673 GAAGTCTTAAAAGCCCAGATTGG + Intergenic
1023423269 7:40006903-40006925 TAGGTCTTACCAGCAGAGACTGG - Intronic
1024670426 7:51589089-51589111 GATGTCTTAAATGGACAGACTGG + Intergenic
1025951982 7:66152600-66152622 GAAATCTTTCAAGCACAGAGGGG - Exonic
1030278970 7:107750622-107750644 GAAGTCATAAAAGCAAAGACCGG - Intronic
1030452980 7:109735908-109735930 GATTTTTTTAAAGCACAGACAGG + Intergenic
1032426351 7:131825344-131825366 AATGTCCAACAAGGACAGACTGG - Intergenic
1032861618 7:135885182-135885204 GATGTGTTAGAAGCACTCACGGG + Intergenic
1038623149 8:29164179-29164201 GATGTTATATTAGCACAGACTGG - Intronic
1040032673 8:42840566-42840588 GATCTCTTACTAGCAGAGTCAGG - Intronic
1042525930 8:69764833-69764855 GCTATCTTACACACACAGACAGG + Intronic
1042651727 8:71050041-71050063 TATTTGTTAAAAGCACAGACTGG + Intergenic
1043587869 8:81790620-81790642 GATATCCTAGAAGCAGAGACTGG - Intergenic
1044196726 8:89385814-89385836 GATGTGACACAAGCAAAGACTGG + Intergenic
1046526447 8:115387258-115387280 GATGTCCAACAATCATAGACTGG - Intergenic
1048681012 8:136842054-136842076 GATGTTCTAAAAGCACAGCCAGG - Intergenic
1051051110 9:12932122-12932144 CCTGTCTTACATGCAGAGACAGG - Intergenic
1052591439 9:30501412-30501434 GATGTCCAACAATGACAGACTGG - Intergenic
1053190127 9:36058254-36058276 GATGTCCAACAATGACAGACTGG + Intronic
1056822592 9:89854053-89854075 CAGGTCCTACAAGCACAGCCCGG - Intergenic
1186269644 X:7872720-7872742 AATGTTTTAAAACCACAGACTGG - Intergenic
1186999959 X:15166575-15166597 GATGTCTTTCAATCACAAAAAGG - Intergenic
1190652317 X:52579248-52579270 GAAGTCTTACTTGCACAGACAGG + Intergenic
1195453810 X:105045170-105045192 AATGTCATACAAGCAAAGAAAGG + Intronic
1195997157 X:110742690-110742712 GATGTGGTAGAAGCACAGTCCGG + Intronic
1198925125 X:141782083-141782105 GTTGACTCACAAGCACAGATAGG - Intergenic
1202077160 Y:21048141-21048163 GATGTCTGACAATGATAGACTGG - Intergenic
1202360938 Y:24109762-24109784 AATGTCTAACAACGACAGACTGG - Intergenic
1202509840 Y:25560356-25560378 AATGTCTAACAACGACAGACTGG + Intergenic