ID: 967352135

View in Genome Browser
Species Human (GRCh38)
Location 3:188525524-188525546
Sequence CTATGTAAGGTTAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967352135 Original CRISPR CTATGTAAGGTTAAGGTGAA GGG Intronic
904660593 1:32081502-32081524 CTTTGGAAGGCCAAGGTGAATGG + Intronic
905710918 1:40102239-40102261 CTTTGTGAGGTCAAGGTGAATGG + Intergenic
906283738 1:44571926-44571948 CTATTTAAGGGTAGGATGAACGG - Intronic
907887242 1:58604689-58604711 TTATCTAAAGTCAAGGTGAAGGG - Intergenic
909012504 1:70350915-70350937 CTTTGGAAGGTTGAGGTGAGTGG + Intronic
911621738 1:100073104-100073126 GAATGTAAGGTTAGGGAGAAAGG - Intronic
911876653 1:103172757-103172779 ATATGTATGGTTTAGGTGAGTGG - Intergenic
913662593 1:121017864-121017886 CTCTGTGAGGTCAATGTGAAGGG - Intergenic
913667547 1:121062425-121062447 CTCTGCAAGGTCAATGTGAAGGG - Intergenic
914013980 1:143801125-143801147 CTCTGTGAGGTCAATGTGAAGGG - Intergenic
914163843 1:145160072-145160094 CTCTGTGAGGTCAATGTGAAGGG + Intergenic
914253861 1:145944782-145944804 CTTTGGAAGGCTGAGGTGAAAGG + Intronic
914652598 1:149709681-149709703 CTCTGTGAGGTCAATGTGAAGGG - Intergenic
916483112 1:165233209-165233231 CTATGGAAGGCTAAGGTGAGTGG + Intronic
918230249 1:182523282-182523304 CTTTGGAAGGTTAAGGTGGGAGG - Intronic
919236597 1:194853197-194853219 CTAGGAAAGGTTAAGGGAAATGG - Intergenic
919370691 1:196722524-196722546 CTATCTAAAGTCAATGTGAACGG - Intronic
919712482 1:200741043-200741065 CTATGTAATGTTTTGGTAAATGG + Intronic
922844795 1:228676212-228676234 CTTTGGAAGGTCAAGGTGAAAGG - Intergenic
923281613 1:232448590-232448612 GTATGTAAGTTGGAGGTGAATGG + Intronic
924117003 1:240757706-240757728 TTATGTAAGTTAAAGGTTAAAGG - Intergenic
924517171 1:244775902-244775924 CTTTGGAAGGCTAAGGCGAAAGG + Intergenic
924732723 1:246726479-246726501 CTTTGGAAGGTCAAGGTGCAAGG - Intronic
1063708371 10:8453183-8453205 CTAAGTGAGGTTAAAGTGGAAGG - Intergenic
1065334588 10:24643637-24643659 CTTTGAAAGGTTAAGGGGAAAGG - Intronic
1065386535 10:25139184-25139206 CTTTGAGAGGTCAAGGTGAAAGG - Intergenic
1066175695 10:32902987-32903009 CTATGCAAAGTCAAGGTGTAGGG + Intronic
1068260424 10:54573844-54573866 CTAAGTAAGGATAAGGTGCAGGG - Intronic
1070108783 10:73462265-73462287 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1071148265 10:82600709-82600731 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1072497687 10:95978613-95978635 CTTTGTGAGGCCAAGGTGAAAGG - Intronic
1072841004 10:98773808-98773830 CTTTGGGAGGCTAAGGTGAAAGG + Intronic
1073293779 10:102426027-102426049 CTATGTAGGGTTAAGGGGCATGG - Intronic
1080525605 11:33113810-33113832 CTTTGGAAGGCTGAGGTGAATGG + Intronic
1080743807 11:35089639-35089661 TTTTGTAAGGTTATGATGAACGG + Intergenic
1082056643 11:47823297-47823319 TTATGCAAGGTGAAGATGAAAGG - Intronic
1082193076 11:49270482-49270504 CTTTGAGAGGCTAAGGTGAAAGG - Intergenic
1083253173 11:61481425-61481447 GTATGTAAGGTTCAGGTCAGGGG + Intronic
1083438707 11:62661686-62661708 CTTTGGGAGGTTAAGGTGGATGG + Intronic
1083788102 11:64965507-64965529 CTTAGGATGGTTAAGGTGAAAGG - Intronic
1084384742 11:68836230-68836252 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
1085790914 11:79497034-79497056 CTATGTAAGGTAAACTTGACAGG - Intergenic
1085974520 11:81636077-81636099 CTTTTAAAGGTTAAGGTTAAAGG - Intergenic
1086673053 11:89570587-89570609 CTTTGAGAGGCTAAGGTGAAAGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG + Intergenic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1091827525 12:3524088-3524110 TTATGGAATGTCAAGGTGAATGG - Intronic
1094560288 12:31546441-31546463 CTCTGGAAGGCTAAGGTGAGTGG + Intronic
1095117184 12:38368632-38368654 CTATGTAAGGCTCAGGTTAGTGG - Intergenic
1097199336 12:57264967-57264989 CTATTTGAGGGTAGGGTGAAAGG + Intronic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1097891846 12:64784535-64784557 CTAGCTAAGGTTAAGTTGAGTGG + Intronic
1098023797 12:66182030-66182052 CTTTGTGAGGCTAAGGTGGAAGG + Intergenic
1102081639 12:110103120-110103142 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1102112554 12:110375418-110375440 GTCTGTAAGGTTATGGTGAAGGG - Intronic
1105906516 13:24816141-24816163 CTTTGGGAGGGTAAGGTGAAAGG - Intronic
1106105291 13:26727820-26727842 CTGTGTTAGTTCAAGGTGAAGGG + Intergenic
1106237104 13:27872369-27872391 CTTTGGAAGGCTGAGGTGAATGG - Intergenic
1107036450 13:35907404-35907426 CTTTGGAAGGCTAAGGTGAGAGG - Intronic
1107737052 13:43410327-43410349 CTATGTAAGCTTTAGGGAAAAGG + Intronic
1108455586 13:50610557-50610579 CAATGTAATGCGAAGGTGAAGGG - Intronic
1109976833 13:69848031-69848053 CTATTTAAGGTGCTGGTGAAAGG + Intronic
1112304501 13:98261385-98261407 CAATGGGAGGTCAAGGTGAACGG - Intronic
1113717112 13:112518649-112518671 CTAGTTAAGGATAATGTGAAAGG - Intronic
1113978961 13:114255873-114255895 CTCTGGGAGGCTAAGGTGAAAGG - Intronic
1116019013 14:39439492-39439514 CTATGAAAGGCTAAGGTGGGAGG - Intergenic
1116259673 14:42608293-42608315 CTATGGGAGGTTGAGGTGAGAGG - Intergenic
1116812320 14:49551305-49551327 CTGTGTAAAGTTAACGTGAAAGG + Intergenic
1117745773 14:58867891-58867913 CTTTGGGAGGTCAAGGTGAAAGG - Intergenic
1118588278 14:67377862-67377884 CTATGTAAGGCTGAGGTGGGAGG + Intronic
1118805359 14:69231792-69231814 CTATGAAAGAGAAAGGTGAAGGG - Intronic
1121178857 14:91912251-91912273 CTTTGGAAGGTTAAGGTGTGAGG + Intronic
1121568346 14:94927340-94927362 CAATGCAAGGTGGAGGTGAAGGG + Intergenic
1121664099 14:95658809-95658831 CAGTGTATGGTAAAGGTGAAGGG - Intergenic
1122589541 14:102837380-102837402 CTTTGGAAGGTCAAGGTGGAAGG - Intronic
1127431044 15:58908610-58908632 CTTTGGAAGGTTGAGATGAAAGG - Intronic
1130292413 15:82614246-82614268 CTTTGGGAGGTTAAGGTGAGAGG - Intronic
1130845267 15:87738186-87738208 CTATGTCTGGTAAAGGTGGAAGG + Intergenic
1131083829 15:89559005-89559027 CTCTGAAAGGTTGAGGGGAAAGG + Intergenic
1131147183 15:90021606-90021628 CTCTGTCATATTAAGGTGAATGG + Intronic
1131627062 15:94132642-94132664 CTATCCAAGGTTAATATGAAGGG - Intergenic
1132290391 15:100696941-100696963 TTTTGAAAGGTTAATGTGAATGG + Intergenic
1135379513 16:21982719-21982741 CTTTGGGAGGTTAAGGTGAGTGG + Intronic
1137418655 16:48311087-48311109 CTGTCTAAGGTCAATGTGAAGGG - Intronic
1138478393 16:57285095-57285117 CTTTGGGAGGCTAAGGTGAAAGG + Intergenic
1138601755 16:58059721-58059743 ATCTGGAAGGTTAAGGAGAAAGG + Intergenic
1140238298 16:73178729-73178751 ATTTGGAAGGTTAAGGTGAGAGG - Intergenic
1141060342 16:80861331-80861353 CTTTGGAAGGTCAAGGTGAGAGG + Intergenic
1141119390 16:81340180-81340202 CTTTGTAAGGCTGAGGTGAGAGG - Intronic
1141487670 16:84351699-84351721 CTTTGAAAGGTCAAGGTGAGAGG - Intergenic
1143552297 17:7637889-7637911 CTTTGGGAGGCTAAGGTGAATGG + Intergenic
1143913659 17:10273004-10273026 CTTTGGAAGGTCAAGGTGAGCGG - Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1146711740 17:35047993-35048015 CTGTGGAAGGCCAAGGTGAATGG - Intronic
1150190152 17:63230037-63230059 CTTTGGGAGGTTGAGGTGAAAGG - Intronic
1150968435 17:69998664-69998686 CTATGATTGGTTAAGGAGAAAGG + Intergenic
1151783045 17:76260193-76260215 CTTTGTAAGGTCAAGGTGAGAGG + Intergenic
1152856783 17:82669092-82669114 CTTTGGGAGGTTAAGGTGAGAGG + Intronic
1153245705 18:3071334-3071356 CTATGAAACGTTAAGATGATTGG + Intronic
1155169357 18:23255802-23255824 CTTTGGGAGGTTGAGGTGAAAGG - Intronic
1155327691 18:24681649-24681671 CTTTGGAAGGTTGAGGTGAGAGG + Intergenic
1155810130 18:30222165-30222187 CTTTGGAAGGCTAAGGCGAAAGG + Intergenic
1155838876 18:30623263-30623285 CTATGTAAGGTTTCAGTGAGGGG + Intergenic
1156231810 18:35160573-35160595 CTTTGGAAGGCTGAGGTGAAAGG - Intergenic
1157181986 18:45506232-45506254 CTAAGTGAGGATAAAGTGAAGGG - Intronic
1157918586 18:51693699-51693721 CAAGATAAGGTTAAAGTGAAAGG + Intergenic
1158494287 18:57940183-57940205 CAACGTAAGGTGAAGGTGGATGG - Intergenic
1159405687 18:67999847-67999869 CTGTGAAAGATTAAAGTGAATGG + Intergenic
1160072454 18:75640542-75640564 CTCTGTAAGGTTTAAGTGGAAGG - Intergenic
1160613652 18:80108377-80108399 CTAGGTGAGGTTCAGGTGCAGGG + Intergenic
1163363259 19:16861381-16861403 CTTTGGGAGGTTGAGGTGAAAGG + Intronic
1163908692 19:20169548-20169570 GTAGTTAAGATTAAGGTGAAAGG + Intronic
1163944601 19:20523565-20523587 GGATGTAAGTTTAAGGAGAAAGG + Intergenic
1167849957 19:52193866-52193888 CTTTGGAAGGCCAAGGTGAAAGG + Intronic
1168020350 19:53604597-53604619 CTTTGGAAGGCTAAGGTGAGCGG + Intergenic
926559199 2:14396511-14396533 CTATTTAAGGCTCAGTTGAAGGG + Intergenic
933382612 2:81568816-81568838 CTTTGGGAGGTTAAGGTGAAAGG + Intergenic
937670394 2:124532043-124532065 CTATGTATTGTTAAGCTGTAGGG + Intronic
938732423 2:134156970-134156992 CTAGGTAAGCTTATGGTGTAGGG + Intronic
939019236 2:136939444-136939466 GTATGTTAGGTAAAAGTGAATGG - Intronic
940100866 2:150036812-150036834 CTATCCAAGGTGAAAGTGAAAGG + Intergenic
940816254 2:158301100-158301122 CTTTGGAAGGTTAAGGTGGGAGG - Intronic
941955407 2:171199265-171199287 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
942352085 2:175063500-175063522 CTATGGTAGGCTAAGGTGGAAGG - Intergenic
943197998 2:184780274-184780296 CTATGTAGAGTTACGGAGAAGGG + Intronic
943530363 2:189072203-189072225 CTTTGTAATTTTAAAGTGAAAGG - Intronic
944084398 2:195827687-195827709 CTATGTGAGGTTGAGGTGGGAGG - Intronic
944611724 2:201416142-201416164 CTTTGGGAGGTCAAGGTGAAAGG + Intronic
944925218 2:204457208-204457230 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948331547 2:237170715-237170737 CTTTGGGAGGCTAAGGTGAACGG + Intergenic
1168872566 20:1143447-1143469 TTATAGAAGGTTAAGGTCAAGGG - Intronic
1170273878 20:14561486-14561508 CTATGTTAGGTTTAGGTGCAGGG + Intronic
1173808694 20:45942854-45942876 CTTTGGAAGGCTAAGGTGGAAGG - Intronic
1174666946 20:52267345-52267367 CTTTGGAAGGTTGAGGTGAGAGG + Intergenic
1175675703 20:60945105-60945127 CTTTGGGAGGTTAAGGTGAGTGG - Intergenic
1176901258 21:14444970-14444992 TGATGTAAGGGTGAGGTGAAGGG - Intergenic
1177358660 21:20040655-20040677 CTCTCTAAGGTGTAGGTGAAAGG - Intergenic
1177653325 21:23985439-23985461 CTTTGTAAGGCTGAGGTGAGTGG + Intergenic
1177948248 21:27500521-27500543 CTAGGTCAGGTTATGTTGAAAGG - Intergenic
1178509198 21:33188609-33188631 CTTTGGAAGGCTGAGGTGAACGG - Intergenic
1183923983 22:41192536-41192558 CTATGGGAGGTAAAGGTGAGAGG + Intergenic
1184376392 22:44116548-44116570 CTCTGTAAGGATGTGGTGAATGG - Intronic
949435118 3:4020754-4020776 ATACATAAGGTGAAGGTGAATGG - Intronic
951313027 3:21152812-21152834 GTATGTACAGTTATGGTGAAAGG - Intergenic
952144262 3:30514656-30514678 CTTTGGAAGGCTGAGGTGAAAGG - Intergenic
957757971 3:84515384-84515406 CTATCCAAGGTCAATGTGAAAGG - Intergenic
959335132 3:105054805-105054827 CTTTGAAAGGTCAAAGTGAAAGG - Intergenic
959927616 3:111941498-111941520 CTATTTTAGGTTAAGAGGAAAGG + Intronic
961652435 3:128423368-128423390 CTATGGGAGGCTGAGGTGAAAGG + Intergenic
962605715 3:137031340-137031362 CTTTGGAAGGCTAAGGTGGAAGG - Intergenic
963309194 3:143689651-143689673 CTATGTGAGGCCAAGGTGAGAGG - Intronic
963980065 3:151527704-151527726 CTTTGGAAGGCTGAGGTGAAAGG + Intergenic
964489707 3:157222955-157222977 CTTTGGAAGGTTATGGTGAGAGG - Intergenic
964708483 3:159646551-159646573 CTGTGAAAGGTTAAGGGGAGAGG - Intronic
964874787 3:161354587-161354609 CTATGGGAGGTCAAGGTGGAAGG - Intronic
966002430 3:174966540-174966562 CGATGTAAGGATAAAGTGATAGG + Intronic
967352135 3:188525524-188525546 CTATGTAAGGTTAAGGTGAAGGG + Intronic
971062709 4:22990490-22990512 CTCCGTAAGGTTAAGGTGAGTGG + Intergenic
971881080 4:32373421-32373443 CTATATAATGATAAGGTGACAGG - Intergenic
972501712 4:39683980-39684002 CTTTGAAAGGCTAAGGTGCATGG - Intergenic
975001613 4:69230367-69230389 CTATGTAATAGTATGGTGAAGGG + Intergenic
975003830 4:69261750-69261772 CTATGTAATAGTATGGTGAAGGG - Intergenic
975012190 4:69370257-69370279 CTATGTAATAGTATGGTGAAGGG - Intronic
978359851 4:107919318-107919340 CTTTGGGAGGTTAAGGTGGATGG + Intergenic
979781413 4:124655185-124655207 GTATGGAAGGTGAAGTTGAATGG + Intergenic
986039276 5:3971999-3972021 CTTTGGGAGGTTGAGGTGAAAGG - Intergenic
988924259 5:35973359-35973381 GTATGTGAGGTAATGGTGAAAGG + Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994303071 5:98170489-98170511 CTATGTAATTTAAAGGTGAGAGG - Intergenic
994950424 5:106454432-106454454 CTCAGTAAGGTTAAGGGAAATGG - Intergenic
996039961 5:118798323-118798345 CCATGTAAGGATACAGTGAAAGG + Intergenic
996184203 5:120456880-120456902 CTGTGTAAGGCTAAAGTGTAAGG - Intergenic
996309535 5:122088901-122088923 CTATGTAAGGGCAAAGAGAAGGG - Intergenic
997256723 5:132434685-132434707 CTATGAAAGATAAAGGAGAAAGG + Intronic
997689419 5:135815571-135815593 CTATGTATGGGTAAGGGCAAAGG + Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998676895 5:144419479-144419501 CTGTGTATGTTTAATGTGAATGG + Intronic
998762342 5:145446547-145446569 CTATGTAAGTTTAATGTGGCTGG + Intergenic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
1000327206 5:160181331-160181353 CTTTGCAAGGCTGAGGTGAATGG + Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001391144 5:171380223-171380245 CTATGGGAGGTTAAGGTGGGAGG + Intergenic
1002353148 5:178599482-178599504 CTTTGGGAGGCTAAGGTGAAAGG + Intergenic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1004136462 6:12971946-12971968 CTATGTAAGGTTGGGGTGAGAGG + Intronic
1004151941 6:13128855-13128877 CTATCTAAAGTCAAGATGAAAGG + Intronic
1005575459 6:27185433-27185455 CTATGTAATGTGCAGGTCAAAGG - Intergenic
1006469832 6:34222408-34222430 CTTTGGAAGGCTAAGGTGAGAGG + Intergenic
1008643158 6:53485379-53485401 ATATGAAAGGTTCAGGGGAAAGG + Intergenic
1009609182 6:65916881-65916903 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1011881814 6:92037784-92037806 CTGTGTATGGTTTCGGTGAAGGG - Intergenic
1013150789 6:107444272-107444294 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013382709 6:109592803-109592825 CTATCTAACGTCAATGTGAAGGG - Intronic
1014843258 6:126244403-126244425 CTAGGAAAGGTAAAAGTGAAAGG - Intergenic
1015175141 6:130298085-130298107 CTATCCAAGGTCAATGTGAAGGG + Intronic
1016132275 6:140489020-140489042 ATATGTAAGTTGAAGGTCAAAGG + Intergenic
1017173526 6:151480218-151480240 CTTTGGAAGGCTAAGGCGAATGG + Intergenic
1018556767 6:165058817-165058839 CTATGGAATGTCAGGGTGAAGGG + Intergenic
1019158333 6:170053371-170053393 CTATGTAAGGAAGGGGTGAATGG - Intergenic
1026584372 7:71644291-71644313 CTTTGGAAGGTCAAGGTGAGCGG + Intronic
1026742708 7:72989220-72989242 CTTTGTGAGGCTGAGGTGAAAGG - Intergenic
1027028820 7:74873925-74873947 CTTTGTGAGGCTGAGGTGAAAGG - Intergenic
1027101027 7:75375857-75375879 CTTTGTGAGGCTGAGGTGAAAGG + Intergenic
1027209991 7:76138462-76138484 CTATGTTTGTATAAGGTGAATGG + Intergenic
1030600225 7:111583904-111583926 CTATGTGAGGATACGGTGAGTGG - Intergenic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1032076007 7:128836513-128836535 CTATGAACGGTGCAGGTGAAGGG - Intronic
1034390535 7:150784130-150784152 CTTTGGGAAGTTAAGGTGAAAGG + Intergenic
1038192926 8:25340289-25340311 CTATATAAGGTATAGGTGAATGG + Intronic
1040929899 8:52722427-52722449 CTTTGGGAGGCTAAGGTGAAAGG - Intronic
1041165114 8:55084071-55084093 CTTTGAGAGGTTAAGGTGAGAGG - Intergenic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG + Intronic
1043507951 8:80921423-80921445 CTTTGGAAGGTCAAGGTGAGCGG + Intergenic
1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG + Intronic
1044998908 8:97863187-97863209 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
1045495691 8:102706466-102706488 CTGTGTGAGGTTACAGTGAAAGG + Intergenic
1045512739 8:102825620-102825642 CTTTGGAAGGTTGAGGTGAGAGG - Intergenic
1046032066 8:108794375-108794397 CTAAGTAAGGATAAGGTGTGTGG + Intergenic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1046983760 8:120364637-120364659 CTTTGGAAGGTTAAGGTGGGCGG + Intronic
1048159250 8:131997456-131997478 CTATGTAATGGGAAGTTGAATGG - Intronic
1050521943 9:6510035-6510057 CAGTGTAAGCTCAAGGTGAACGG - Intergenic
1050602824 9:7269790-7269812 CTCTGTCAGGTTGAGATGAATGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051427042 9:16942632-16942654 GAATGTAAATTTAAGGTGAAAGG + Intergenic
1052365343 9:27606469-27606491 CTTTGTAATGGTAAGGAGAAAGG - Intergenic
1056859128 9:90163388-90163410 ATATGTAATGTTAATGTGGATGG + Intergenic
1058018044 9:100058317-100058339 CTTTGGAAGGTTAAGGTGGGAGG - Intronic
1058108558 9:101003788-101003810 CTATAAGAGGTTAAGGTGATTGG + Intergenic
1058228244 9:102393518-102393540 CTTTGTATGGTTAAGGGGAATGG + Intergenic
1058302744 9:103397049-103397071 CTATCCAAGGTCAAAGTGAAAGG - Intergenic
1058805193 9:108583645-108583667 CTATTTAAAATAAAGGTGAAAGG - Intergenic
1059309771 9:113380250-113380272 CTTTGGAAGGCTAAGGTGGAAGG + Intergenic
1059538490 9:115107127-115107149 CCTTGTTAGGTTAAGGTGACTGG + Intronic
1060039300 9:120285977-120285999 TTAAGGAAGGTTAAGTTGAAGGG + Intergenic
1060906572 9:127312482-127312504 CTATGTACATTTAAAGTGAAGGG + Intronic
1060949943 9:127595105-127595127 CTTTGAAAGGTCAAGGTGAGAGG - Intergenic
1061210919 9:129192617-129192639 CTGTGTGAGGTTGAGGTGAGAGG + Intergenic
1186601187 X:11039066-11039088 CTATGGAAGGATCAGATGAATGG - Intergenic
1186880985 X:13866037-13866059 CTATGGAGGGTTATGGTGAGGGG + Intronic
1187105687 X:16239181-16239203 CTAAGAAAGGTTAAGGTGATGGG - Intergenic
1187487883 X:19721753-19721775 CTATGGGAGGTCAAGGTGGAAGG + Intronic
1188213876 X:27454500-27454522 CTCTATAAGGTAAAGGGGAAAGG - Intergenic
1188805163 X:34579063-34579085 CTATGTAAGATAAGGGGGAAGGG + Intergenic
1188850810 X:35129494-35129516 AGATGTAAGGAAAAGGTGAATGG - Intergenic
1189307713 X:39999525-39999547 CTTTGAAAGGTTAAGGTGGGAGG + Intergenic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1190186781 X:48242043-48242065 CTTTGAAAGGTTGAGGTGGACGG + Intronic
1190210736 X:48444909-48444931 CTTTGAAAGGTTGAGGTGGATGG + Intergenic
1191787445 X:64932223-64932245 TCATGTAAGCTTAAGGTAAAGGG - Intronic
1192043036 X:67643439-67643461 CTCTGGAAGGTAAAGGAGAAAGG - Intronic
1192442995 X:71188797-71188819 CTGTGAGAGGTCAAGGTGAATGG + Intergenic
1194017723 X:88645503-88645525 CTATGTACAGTCATGGTGAAGGG + Intergenic
1194237350 X:91400480-91400502 TTATCTAAAGTTAAGATGAAGGG + Intergenic
1197547924 X:127850125-127850147 ATATGTAAAGTTAAGGAGAAGGG + Intergenic