ID: 967355814

View in Genome Browser
Species Human (GRCh38)
Location 3:188569713-188569735
Sequence ATGTTTCAGCCTCGGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967355808_967355814 24 Left 967355808 3:188569666-188569688 CCCAGAAGGTTGTATGTAACTCA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 967355814 3:188569713-188569735 ATGTTTCAGCCTCGGCCATCTGG 0: 1
1: 0
2: 2
3: 5
4: 124
967355809_967355814 23 Left 967355809 3:188569667-188569689 CCAGAAGGTTGTATGTAACTCAT 0: 1
1: 0
2: 1
3: 8
4: 84
Right 967355814 3:188569713-188569735 ATGTTTCAGCCTCGGCCATCTGG 0: 1
1: 0
2: 2
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967355814 Original CRISPR ATGTTTCAGCCTCGGCCATC TGG Intronic
901245013 1:7723319-7723341 GTGTTCCAGCTTTGGCCATCAGG - Intronic
903413417 1:23165736-23165758 ATCTTTCAGCCTGGACTATCCGG + Intronic
904217516 1:28934610-28934632 TTGTTCCAGCTTTGGCCATCAGG + Intronic
907002562 1:50876556-50876578 ATGTTTTAGCTTTGGCCATTGGG - Intronic
908244289 1:62215425-62215447 ATATTTCATCCTAGGCCTTCAGG - Intergenic
908819430 1:68068380-68068402 TTGTTTCAGCTTTGGCCATTGGG + Intergenic
909008065 1:70300479-70300501 ATTCTTCAGCCTCAGCCTTCAGG - Intronic
910717772 1:90251127-90251149 ATGTTCCAGCCATGGCAATCAGG + Intergenic
911067704 1:93806292-93806314 ATATTTAAGCCTCAACCATCTGG - Intronic
911273100 1:95827477-95827499 ATTTTTCAGCCCCTGCCATATGG + Intergenic
911485887 1:98504553-98504575 ATATTTCAGCATCGACCATCTGG + Intergenic
914257502 1:145972597-145972619 TTGTTTCAGCTTTGGCCATTGGG + Intronic
920872148 1:209803745-209803767 ATGTTTCTGTCTTGGCCATTTGG - Intronic
922299304 1:224282266-224282288 AGGTTTCAGCCTGGGCAATGTGG - Intronic
923717415 1:236436936-236436958 ATGTTTCACCATCTACCATCTGG - Intronic
1070468879 10:76757126-76757148 ATGTTCCAGCCTTGGCCATTGGG - Intergenic
1071857040 10:89636243-89636265 ACGTGTCTGCCTGGGCCATCAGG + Intronic
1077350853 11:2092600-2092622 AAGCCTCAGCCTCTGCCATCAGG - Intergenic
1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG + Intergenic
1081636065 11:44723078-44723100 ACGTTCCAGTCTTGGCCATCTGG - Intergenic
1081822635 11:46014584-46014606 TTAGTTCAGCCTCGGCCATTTGG - Intronic
1082294186 11:50417995-50418017 CTGTTCCAGCCTTGGCCATTGGG - Intergenic
1084092357 11:66886983-66887005 AGGCTCCAGCCCCGGCCATCAGG + Intronic
1084469750 11:69352195-69352217 ATGTCTCAGCTCAGGCCATCAGG + Intronic
1085274453 11:75289430-75289452 CTGTGTCTGCCTCTGCCATCTGG + Intronic
1086998615 11:93389730-93389752 ATGTTTCAATCTAGGCAATCTGG + Intronic
1088100372 11:106147796-106147818 ATGTTTCAGCTTAAGCAATCAGG - Intergenic
1090238001 11:125163882-125163904 CTGTTTCAGCCTGGGCCTGCTGG - Intergenic
1090973387 11:131661552-131661574 ATGTTTCAGCCTCGGCGACCAGG - Intronic
1091891557 12:4059046-4059068 TTGTTTCAGCTTTGGCCATTGGG + Intergenic
1093884753 12:24446919-24446941 TTGTTTCAGCTTTGGCCATTGGG - Intergenic
1094586988 12:31786739-31786761 ATGTCTCAGCCTCCGCCGCCTGG + Intergenic
1096180257 12:49546738-49546760 ATCTTTCAGTCTTGGCCATGGGG - Intronic
1096684326 12:53277773-53277795 CTGTCTCAGCATGGGCCATCTGG - Intronic
1098778955 12:74659681-74659703 TTGTTTCAGCTTGGGCCATTGGG + Intergenic
1101264919 12:103074190-103074212 ATTTTTCATCCTCAGCCCTCTGG - Intergenic
1106890431 13:34239642-34239664 ATTTTTCATACTCAGCCATCTGG + Intergenic
1109155844 13:58907715-58907737 ATGTTTCAAAGTCAGCCATCTGG + Intergenic
1111516063 13:89333226-89333248 ATGTTTCAGTCTATGCCTTCAGG + Intergenic
1112404474 13:99106666-99106688 TTGTTGCAGCCTCAGCCTTCTGG - Intergenic
1116936918 14:50750070-50750092 TTGTTCCAGCTTTGGCCATCAGG + Intronic
1125047633 15:35260762-35260784 ATGTTTTAGCCTCTGACCTCAGG + Intronic
1127721609 15:61706971-61706993 ATGTTTCAGATTTGGCCATTGGG - Intergenic
1132473643 16:121108-121130 ATGTCTCAGCCTCAGCCCTCAGG + Intronic
1134026844 16:10960842-10960864 TTGTTTCAGCCTTGGCTATTAGG + Intronic
1139221892 16:65191632-65191654 TTGTTCCAGCCTTGGCCATTGGG + Intergenic
1141952647 16:87348645-87348667 CTGTTACAGCCTCACCCATCTGG + Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1152001575 17:77649020-77649042 TTGTCCCAGCCTTGGCCATCGGG + Intergenic
1152351561 17:79786437-79786459 ATCTGTCAGCCTCGGCCCTGAGG + Exonic
1152567931 17:81108453-81108475 ATGTTTCTGCCTCTGCCCCCAGG + Exonic
1154071270 18:11153972-11153994 ATGTTTTAGCATTGGCCACCTGG - Intergenic
1156643437 18:39130196-39130218 TTGTTTCAGCTTTGGCCATTGGG + Intergenic
1158903350 18:61986831-61986853 ATCCTTCAGCCTCAGCCACCTGG - Intergenic
1160426140 18:78780464-78780486 CTGTTTCAGCCTCTGCTCTCTGG - Intergenic
1161672318 19:5621062-5621084 ACGTTTCAGCTTCTGCCATTGGG - Intronic
927725792 2:25421806-25421828 ATGTTTCATACTTGGACATCTGG + Intronic
928838442 2:35575781-35575803 ATGCTGCAGCCTGGGCCATAGGG + Intergenic
929262151 2:39877717-39877739 ATGTTCCAGCCAGGGCAATCAGG - Intergenic
931447946 2:62342781-62342803 TTGCTTCAGCCTCGGCCTCCTGG + Intergenic
934918483 2:98321054-98321076 CTGTTTCAGCTTCAGCCATGAGG + Intergenic
936056503 2:109265630-109265652 CTGTTTCAGCGTTGGCCACCTGG - Intronic
939059367 2:137401034-137401056 GTGCTTCAGCCTTGGCCAGCAGG + Intronic
945204907 2:207320961-207320983 TTGTTCCAGCTTCGGCCACCGGG - Intergenic
947759771 2:232595359-232595381 TTGTTTCAGCTTTGGCCATTTGG - Intergenic
1169859035 20:10132522-10132544 ATTTTTCAGCCTCCTCCAGCTGG - Intergenic
1175436993 20:58959980-58960002 CTTTTTCAGCCTGGGCCATGGGG - Intergenic
1175941905 20:62541282-62541304 AGAATTCAGCCTCTGCCATCGGG + Intergenic
1178163246 21:29942719-29942741 ATATTTCAGTCTCTGCAATCTGG - Intergenic
1183961817 22:41415844-41415866 TTGGTTCAGCCTCAGCCTTCAGG + Intergenic
1184969680 22:48007097-48007119 ATGTGTCAGCTTTGGCCATGGGG + Intergenic
951363040 3:21747480-21747502 ATGTCTCACCCTTTGCCATCAGG - Intronic
956756612 3:72394378-72394400 TTGTTCCAGCTTTGGCCATCAGG + Intronic
958518074 3:95147348-95147370 TTGTTTTAGCTTTGGCCATCGGG + Intergenic
959574204 3:107916935-107916957 TTGTTTCAGCTTTGGCCATTGGG - Intergenic
959834443 3:110902151-110902173 AGGTTTCTGCCTTGGACATCAGG + Intergenic
960697153 3:120407333-120407355 AAGTGTCAGCCCTGGCCATCAGG + Intronic
960721788 3:120631773-120631795 ATGTTGGACCCTCCGCCATCAGG + Intronic
964172725 3:153790096-153790118 ATGTTCCACCCACTGCCATCTGG + Intergenic
965849204 3:173002139-173002161 TTGTTTCAGCTTTGGCCATTGGG + Intronic
967355814 3:188569713-188569735 ATGTTTCAGCCTCGGCCATCTGG + Intronic
970194978 4:13544030-13544052 ATCCTTGAGCCTCGGCCAGCCGG - Exonic
973810620 4:54566601-54566623 TCATTTCAGCCTGGGCCATCTGG + Intergenic
973957213 4:56074690-56074712 AAGTTCCAGCCACGGCAATCAGG - Intergenic
974081370 4:57216826-57216848 ATGTGTCAGCCTTGCCTATCAGG + Intergenic
974615261 4:64271865-64271887 CTTTTTCAGCCTCTGCCATTCGG - Intergenic
977540817 4:98316625-98316647 TCTTTTCAGCCTCTGCCATCTGG - Intronic
988559076 5:32264074-32264096 ATGATTCAGCCTTGGCTAGCAGG - Intronic
990772102 5:59259575-59259597 ATGTTTCAGCTTCTTGCATCAGG - Intronic
993060489 5:83032708-83032730 ATGTTTCAGCTTTGGCTATTAGG - Intergenic
993219509 5:85072957-85072979 ATGTTTCTTCCTTGGCCATATGG + Intergenic
995213055 5:109562354-109562376 AGGTATCAGCCTCTGTCATCAGG + Intergenic
995795538 5:115937265-115937287 TTGTTTCAGCTTTGGCCATGAGG - Intergenic
996442901 5:123512207-123512229 ATCCTTCTGCCTCGGGCATCCGG - Intronic
997001977 5:129772302-129772324 ATGAGACAGCCTCAGCCATCAGG + Intergenic
997235539 5:132270194-132270216 ATGTTTCAGCCATGGGCACCAGG + Intronic
998357136 5:141548594-141548616 ATGTTCCAGCCTGGGCAATAAGG + Intronic
998690409 5:144581323-144581345 GGGTCTCAGCCTCGTCCATCCGG - Intergenic
1000458174 5:161479118-161479140 ATGTTTCATCTTGGTCCATCAGG - Intronic
1001957759 5:175859933-175859955 AGGTTTCTGTCTCGGCCACCTGG - Intronic
1003192250 6:3884632-3884654 ATGATGCAACCTCGGCCAGCTGG + Intergenic
1012140143 6:95616448-95616470 AAGTCTCTGCCTCGGCCCTCAGG - Intergenic
1013087984 6:106872833-106872855 ACATTTCATCCTCTGCCATCTGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015283030 6:131454282-131454304 ATGTTTCATACTAGGCGATCTGG + Intergenic
1015646283 6:135392178-135392200 ATGTTACAGTCTCTGCCTTCAGG - Intronic
1017803353 6:157920299-157920321 ATGGTTCAACCTTGGCTATCAGG + Intronic
1017828052 6:158097257-158097279 GTGTTTCAGCCTCGTCTGTCCGG + Exonic
1020023075 7:4880691-4880713 ATGGTACAGCCTCTGCCACCAGG + Intronic
1021743768 7:23716708-23716730 ATTATTCAGCCTTGGCCATTGGG + Intronic
1022982993 7:35622360-35622382 TTGTTTCAGCTTTGGCCATTGGG - Intergenic
1033398230 7:140995881-140995903 TTGTTTCAGCCTTGGCCATAGGG + Intergenic
1036504056 8:9339307-9339329 ATGGTTCAGCCTCTGGCCTCAGG + Intergenic
1041577367 8:59414395-59414417 TTGTTTCAGCTTTGGCCATTGGG - Intergenic
1041742387 8:61169740-61169762 GTGTTTAAGCCTCAACCATCTGG + Intronic
1042136906 8:65641356-65641378 TTGTTTCAGCTTTGGCCATTGGG - Intergenic
1042782285 8:72504957-72504979 TTGTTTCAGCTTTGGCCATTGGG - Intergenic
1046056353 8:109083466-109083488 ATGATTCAGCTTTGGCCATGAGG - Intergenic
1046066530 8:109203522-109203544 CTGTTTCAGCCTTGGCCATTGGG + Intergenic
1046471619 8:114682508-114682530 ATGTTTCCGCCTGGGCCATCAGG + Intergenic
1047767502 8:128001484-128001506 GTGTGTCAGCCTCTGCCTTCTGG - Intergenic
1052852850 9:33388271-33388293 CTGTTTCTGGCTCGGCCAACGGG - Intronic
1055632943 9:78242408-78242430 GGGTTTTAGCCTAGGCCATCTGG - Intronic
1058114581 9:101070342-101070364 TTGTTCCAGCCTTGGCCATTGGG + Intronic
1061013769 9:127970552-127970574 AGGTTTCAACCTCTGTCATCAGG - Intronic
1062257540 9:135635233-135635255 AGGCTTCAGCTTTGGCCATCGGG + Intronic
1203773960 EBV:62615-62637 CAGCTTCGGCCTCGGCCATCTGG - Intergenic
1186291354 X:8103300-8103322 ATATTTAAGCCTCAACCATCTGG + Intergenic
1186355203 X:8783407-8783429 AGCCTGCAGCCTCGGCCATCTGG + Intergenic
1192845041 X:74897859-74897881 TTGTTTCAGCTTTGGCCATTGGG - Intronic
1193839077 X:86386654-86386676 TTGTTTCAGCTTTGGCCATTGGG + Intronic
1197070863 X:122296256-122296278 ATGTTCCAGCCAGGGCAATCAGG - Intergenic