ID: 967359310

View in Genome Browser
Species Human (GRCh38)
Location 3:188611457-188611479
Sequence AATAATCTGTTTCTCTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967359310_967359312 27 Left 967359310 3:188611457-188611479 CCAGTTCAGAGAAACAGATTATT 0: 1
1: 0
2: 1
3: 23
4: 249
Right 967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG 0: 1
1: 0
2: 1
3: 10
4: 109
967359310_967359313 28 Left 967359310 3:188611457-188611479 CCAGTTCAGAGAAACAGATTATT 0: 1
1: 0
2: 1
3: 23
4: 249
Right 967359313 3:188611508-188611530 AATTGCAACAGATTTACCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967359310 Original CRISPR AATAATCTGTTTCTCTGAAC TGG (reversed) Intronic
902190153 1:14756810-14756832 ATTAATCTCTTTGTCTTAACTGG + Intronic
902666884 1:17945776-17945798 AAGAATGTGATTCTCTGAACAGG - Intergenic
903220050 1:21864439-21864461 AGTAATCTGTGTTTCTGAATTGG + Intronic
909037203 1:70607276-70607298 AACAATCTGTTTTTCAGTACAGG + Intergenic
909323065 1:74314462-74314484 ACTAATTTACTTCTCTGAACAGG + Intronic
910113744 1:83710011-83710033 AATATACTGTTTCTCTGCAAAGG - Intergenic
910445065 1:87291602-87291624 AATGATCTGTGACTCTGAAAGGG + Intergenic
912081450 1:105942441-105942463 AAAAAGCTGGTTCTCTGAAAAGG - Intergenic
912084253 1:105979315-105979337 AACATTCTGTTTCTCTAAAAAGG - Intergenic
915586666 1:156847505-156847527 GATAATTTGTTTCTTTGGACTGG + Intronic
916293504 1:163191449-163191471 ATTAAACTGTTACTCTGAAGAGG - Intronic
917054614 1:170966738-170966760 AATCTTCTGATTCTCTGACCTGG + Intronic
917058593 1:171011816-171011838 AAAAATCTGTTTATCTTAATAGG + Intronic
917401912 1:174658946-174658968 AATAATCAGTTTTTCTTTACAGG - Intronic
919066580 1:192698687-192698709 AATACTTTGCTTCTCTTAACAGG - Intergenic
921575133 1:216826283-216826305 TATAATATATTTATCTGAACCGG + Intronic
922026646 1:221755849-221755871 AATAATCTGTTATCCTGCACTGG - Intergenic
1063475285 10:6323022-6323044 ACTCATCTGTTTCACTCAACAGG - Intergenic
1064168624 10:13008289-13008311 CATGCTCTGATTCTCTGAACTGG - Intronic
1065602322 10:27382018-27382040 AATGCTTTATTTCTCTGAACTGG - Intergenic
1066007587 10:31160081-31160103 AACAATCTGTGTCTGTCAACAGG - Intergenic
1066151835 10:32629899-32629921 AAACTTCTGTTTCTTTGAACAGG - Intronic
1066247197 10:33595019-33595041 AATAATCTGCTTCTCAGAGGAGG + Intergenic
1066591418 10:36999181-36999203 GATAACCTGGTTCTCTGAAGAGG + Intergenic
1068172823 10:53418316-53418338 AAAAAGCTGTTTCTTTGAACAGG - Intergenic
1068508226 10:57929917-57929939 AATGATTTGTTTCTCTCATCTGG + Intergenic
1068637577 10:59363855-59363877 GATTATCTTTTTCTCTGAACAGG - Intergenic
1068886212 10:62099479-62099501 AATAATATGTTTTTCTGAGCAGG - Intergenic
1069149318 10:64936834-64936856 AATAAACTGTTTCTAAGTACTGG + Intergenic
1069498234 10:68926389-68926411 AGTAATCTGTTTCTGTGATTTGG + Intronic
1074759195 10:116653425-116653447 TAGAATTTGTTTCTCTGAAAAGG + Intergenic
1075387595 10:122068077-122068099 ACTAATCTTTTTCTCTGCAGTGG + Intronic
1075678035 10:124310017-124310039 AATAATCTGTTTTTCCCATCTGG - Intergenic
1078016609 11:7620387-7620409 ATCAATCTCTTCCTCTGAACTGG + Intronic
1078574531 11:12487875-12487897 AATAAACTGTCTCTATGAATGGG + Intronic
1079871352 11:25801910-25801932 AATTATTTGTTTCTCTGTAATGG - Intergenic
1079971488 11:27040934-27040956 AATGAGCTGTCACTCTGAACAGG + Intronic
1080070266 11:28075751-28075773 GAGAATCTGTTTCTCTTAAGAGG + Intronic
1080494846 11:32806952-32806974 AATAATCTGTTTTTAAGAAGGGG + Intergenic
1080980447 11:37397610-37397632 ACTAAACTTTTTCTTTGAACTGG + Intergenic
1082909810 11:58358491-58358513 ACTAATGTGTTTCTCAGAGCAGG + Exonic
1083022590 11:59522354-59522376 AATAATCTGTTTTATTGAGCAGG - Intergenic
1084803476 11:71562895-71562917 AATATCCTGTTTCTAGGAACTGG + Intronic
1085138953 11:74122165-74122187 AAAAATGTGTTTTTCTGCACAGG + Intronic
1086135577 11:83441000-83441022 AATAATTTGTTTCTATCAAGAGG - Intergenic
1086737305 11:90322250-90322272 AATAACCTGTGGCTCTCAACTGG + Intergenic
1086849809 11:91796355-91796377 TATACTCTGTTTCTGTGAATTGG + Intergenic
1087408479 11:97759733-97759755 AAGAATTTTTTTCTCTGAATAGG - Intergenic
1087646317 11:100812356-100812378 ATTAATCTCTTTCTCTGGGCTGG + Intronic
1088200096 11:107322786-107322808 AGTAATCTGTTTTTCTGACTTGG + Intergenic
1088766214 11:112981973-112981995 AATAAGCTGTCTGTCTGAACAGG - Intronic
1091040170 11:132270522-132270544 AAAAATATGGTTCTCTGACCAGG - Intronic
1091171447 11:133523187-133523209 AATAATCTCAATCTCTTAACTGG - Intronic
1094026735 12:25967756-25967778 AATAATCATTTTGTTTGAACTGG + Intronic
1095987365 12:48008229-48008251 ATCCATCTGTTTCTCTGAATTGG - Intergenic
1096136010 12:49201760-49201782 AATAAGCTGTTTATCTGACTTGG - Intronic
1097463512 12:59893083-59893105 ATTTATTTGTTTCTCTGAAAAGG - Intergenic
1097660545 12:62425658-62425680 AATAATCTGTGACCCTGAAGAGG + Intergenic
1098824752 12:75282125-75282147 AATAAACTATTTTTTTGAACTGG - Intronic
1099411668 12:82337098-82337120 AATAATCGGTTTTACTGAAAAGG - Intronic
1102188830 12:110970487-110970509 AATAATATGTTTCCCTGTCCTGG + Intergenic
1102852130 12:116257620-116257642 AGTAATCTCTTTTTCTGTACAGG - Intronic
1106236634 13:27866854-27866876 AATTATTTGTTTATTTGAACTGG - Intergenic
1106686216 13:32062504-32062526 ACTAATCTGCTTCTGTGAATTGG + Intronic
1109587130 13:64420807-64420829 AATAATCTGTTTTAGTGAAAAGG - Intergenic
1109704824 13:66076749-66076771 AAAATTCTGTTTCTCTGTAATGG + Intergenic
1109933042 13:69242601-69242623 ACTAATCTCTTTCTCAGAAGAGG + Intergenic
1110531414 13:76602928-76602950 AGTAATCTGTTTTTCTGCACAGG - Intergenic
1111109128 13:83684528-83684550 AATCATCTGTTTTTCTGCACAGG - Intergenic
1113147684 13:107226448-107226470 AATAATCTGTTTCTTTCACATGG + Intronic
1113277465 13:108747717-108747739 AATGATCTGTTTCTTTTAATTGG - Intronic
1114283402 14:21216414-21216436 AATAATCTGTTTTGCCGGACAGG + Intronic
1114399014 14:22392311-22392333 AACAATCTGTGTCTCTGACTAGG + Intergenic
1115439759 14:33419890-33419912 TATATTCTGTCACTCTGAACGGG - Intronic
1115960179 14:38827673-38827695 AATCACCTGTGTCTCTCAACAGG - Intergenic
1116197297 14:41744564-41744586 ACCAATCTGTGTCTCTGAATTGG - Intronic
1116357936 14:43954674-43954696 AATAATCAGTTTCTTTCAACAGG - Intergenic
1116593062 14:46805264-46805286 TATAAACTGTTTCTATGCACAGG - Intergenic
1117858328 14:60060238-60060260 AGCAATCTGTTTCTCAGCACTGG - Intronic
1120783212 14:88505258-88505280 AATAAACTGTTTCTTTTAAAAGG + Intronic
1125562434 15:40646219-40646241 AAAATTATGTTTCTCTGAAAGGG - Intronic
1126306886 15:47269231-47269253 AATAATCTGTCTTTCAGAAAGGG + Intronic
1126620968 15:50639548-50639570 AATAAACTTTTTTTATGAACAGG - Exonic
1127028176 15:54831619-54831641 AATACTCTGTTTCTGTGGTCAGG + Intergenic
1127330737 15:57937188-57937210 AAGAAACTGATTCCCTGAACAGG - Intergenic
1127470357 15:59284403-59284425 AAATATCTGTTACTCTTAACTGG - Intronic
1138201308 16:55090787-55090809 ATTTACCTGTTTTTCTGAACTGG - Intergenic
1140152801 16:72388958-72388980 AATAATCTCTGTCTCTCATCAGG + Intergenic
1143243338 17:5462546-5462568 AATAAATTGTTTCCCTGCACAGG - Exonic
1143467770 17:7149443-7149465 CATAATCAGTTCCACTGAACTGG + Intergenic
1149032052 17:52095082-52095104 AAAAATGTGTTTCTCTGTTCTGG - Intronic
1150744279 17:67803773-67803795 CATAATCTTTTTTTCTGAACTGG - Intergenic
1152285228 17:79408630-79408652 AAGACTCTGCTTCTCAGAACAGG - Intronic
1153550266 18:6255409-6255431 TAGAATCTGTGTCTCTGAAATGG - Intronic
1153698778 18:7671182-7671204 AATTACCTGTCTCTCTGAATCGG - Intronic
1156852913 18:41748915-41748937 AATTATCTGTTTCTATGAATAGG + Intergenic
1157107540 18:44788753-44788775 AAAAATCAGTTTCTCTGAGTGGG - Intronic
1158578985 18:58665095-58665117 AATAATGTGTTTCAAGGAACTGG + Intergenic
1159695343 18:71550681-71550703 AATAATATTTTTCTATGAATAGG - Intergenic
1159814724 18:73058884-73058906 AATAATCTGACCCTCTGAAGTGG + Intergenic
1163220333 19:15914096-15914118 CTTCATCTGTTTATCTGAACTGG - Intronic
1163902917 19:20122622-20122644 AATAATTTGTTTGTTTGAAGAGG - Intronic
1164373753 19:27666731-27666753 AATATTCTGTTTTTCAGTACTGG + Intergenic
925727587 2:6888736-6888758 AATAATCTGGTTTTCCAAACAGG - Intronic
927822283 2:26278162-26278184 AGTATTCTGTTTCTCTAACCAGG - Intronic
928646504 2:33358280-33358302 AATAATCTCTTTCTCCAAAAAGG + Intronic
930880792 2:56267849-56267871 TTTCACCTGTTTCTCTGAACTGG - Intronic
931617675 2:64176927-64176949 AATAATCTGTTTCTGTTAACAGG + Intergenic
934232873 2:90201642-90201664 TACAATCTGTTTTTGTGAACAGG + Intergenic
934981022 2:98841224-98841246 AATAATCTTTAACTCTTAACTGG + Intronic
936803654 2:116298004-116298026 AATAATGTCTATCTCTGAACAGG - Intergenic
937647392 2:124280933-124280955 ATTAAGCTGTTTCTCTAAATAGG + Intronic
940708208 2:157130081-157130103 AAGAAACTGAATCTCTGAACAGG + Intergenic
941138941 2:161753090-161753112 AATAAATTGTTTCTCTGCATAGG - Intronic
943008066 2:182411075-182411097 AACATTCTGTTTCTTTGATCTGG - Intronic
944725250 2:202465064-202465086 AATTCACTGTTTTTCTGAACAGG - Intronic
945634105 2:212325357-212325379 AATGAATTGTTTCTCTGAAGAGG + Intronic
945988807 2:216375989-216376011 AATAAACTTTATCTCTGAGCAGG + Intergenic
1169230662 20:3886884-3886906 GATATTCTGTTTCTTTGATCTGG - Intergenic
1171020491 20:21580308-21580330 AATAGTCTTTTTCTGTCAACTGG + Intergenic
1172509979 20:35493765-35493787 AGTAATCTCTTTCTCTGTAATGG + Intronic
1178577513 21:33807846-33807868 AACAATCTGCTTCTCTGTTCAGG - Intronic
1178857514 21:36262559-36262581 AATATTCTGCTTCCCTGAAGTGG - Intronic
1182316809 22:29453115-29453137 AAAAATCTGTATTTCTGAAATGG - Intergenic
1182983734 22:34697529-34697551 GCTAATGCGTTTCTCTGAACAGG + Intergenic
950824778 3:15806930-15806952 AATAAGATGTTACTCTCAACTGG + Intronic
951165412 3:19479862-19479884 AATGATCTCTTTCTCTGAATGGG + Intronic
951581979 3:24174201-24174223 AAAAATCTATTTGTCTGAAGTGG + Intronic
952044607 3:29303601-29303623 AATAATGTATTCCTCTCAACAGG - Intronic
953203160 3:40795867-40795889 AAAAAGCTGTTTATCTGAAATGG + Intergenic
954981083 3:54745794-54745816 AATAATTTTTTTTTCTGAATTGG + Intronic
956125884 3:66010501-66010523 AAGAATCTGATCCTCTGACCAGG + Intronic
956377130 3:68625986-68626008 AAAAATCTTTTTCTTTGAAAAGG - Intergenic
956493016 3:69794196-69794218 TATAATCTTTTTCTGTGAAAAGG + Intronic
957446764 3:80322734-80322756 AATAATCTCTTTCTTTAAAAAGG + Intergenic
959126765 3:102299406-102299428 AATAATATGTGTCTCAGAAAAGG - Intronic
959360819 3:105389421-105389443 AATAATGGGCTTCTCTGAAAGGG + Intronic
959957553 3:112256031-112256053 AAGAAAGTGTTTCCCTGAACAGG + Intronic
960139895 3:114141673-114141695 AATTCTCTGGTTCTCTGAAGAGG + Intronic
961225109 3:125237136-125237158 GATAATCAGTTTCTCTTCACTGG - Intronic
964176911 3:153834918-153834940 AATATTCTTTATGTCTGAACTGG + Intergenic
964275196 3:155002144-155002166 AATAATCTGCATCTGTGAAGAGG - Intergenic
964594061 3:158401785-158401807 GGTAATTTGTTTCTGTGAACTGG - Intronic
965517097 3:169633261-169633283 GACAATGTGTTTCTCTGAAGTGG - Intronic
965864283 3:173185182-173185204 AATATTTTGGTGCTCTGAACTGG + Intergenic
965949063 3:174281304-174281326 AATAGTTTGTTTCTCTTATCTGG - Exonic
967081303 3:186052235-186052257 AATGATCTGCTACTCTGACCTGG + Intronic
967359310 3:188611457-188611479 AATAATCTGTTTCTCTGAACTGG - Intronic
968041850 3:195595463-195595485 TACATTCTGTTTCTTTGAACTGG + Intergenic
970044102 4:11830394-11830416 CATATTCTTTTTCTCTGAAGAGG + Intergenic
970055614 4:11968264-11968286 AATAATTTATTTCTCTGTAGAGG + Intergenic
970263692 4:14257337-14257359 AGAAAACTGTTCCTCTGAACAGG + Intergenic
971639556 4:29114004-29114026 AATTATCTGTTTCACTGGATGGG - Intergenic
972713376 4:41621077-41621099 AATAGTCTGTTGCTTTGAAATGG + Intronic
972882300 4:43440300-43440322 AATAATCTGAATCTCTTATCTGG + Intergenic
973781869 4:54295320-54295342 AATAAAGTGGTTTTCTGAACGGG - Exonic
973846343 4:54916887-54916909 CATAATCTATTTATCTCAACTGG - Intergenic
974379537 4:61120674-61120696 AATATTCTGCTTCTCTTAAAAGG + Intergenic
974572718 4:63674871-63674893 AATAATCTCTATCTCTGAAAGGG - Intergenic
975650727 4:76590094-76590116 AATATGCTGGTTCTCTTAACTGG + Intronic
975781392 4:77843905-77843927 ATTAATATGTTTCTTTTAACAGG + Intergenic
976437187 4:85031720-85031742 AATACTCTCTATCTCAGAACAGG - Intergenic
977753875 4:100642199-100642221 AAGAATGTGTTTTTCTGAATTGG - Intronic
980252060 4:130330182-130330204 AATGAACTGTTTCTCTGATCTGG - Intergenic
980518480 4:133897446-133897468 AATAATCTGTTTTTCTTAAAGGG - Intergenic
980735845 4:136887043-136887065 AATAATCTGTATCTGAGACCTGG - Intergenic
982196212 4:152917836-152917858 AAAATTTTGTTTCTCTGAAAAGG + Intronic
982553827 4:156836095-156836117 CATAATCTAGTGCTCTGAACTGG + Intronic
982620631 4:157699551-157699573 AATAATGTGCTTCTCTACACAGG + Intergenic
983143754 4:164187355-164187377 AATAATGTCTTTCTCTAAAGTGG + Intronic
983224967 4:165077393-165077415 AGAAATCTGTTTCTCTGTTCTGG - Exonic
983782047 4:171681625-171681647 AATAATTTGTTTCTCTAATGGGG + Intergenic
984220968 4:176974109-176974131 ATTAATCTGTGTCTATTAACAGG + Intergenic
984820840 4:183880527-183880549 AATTATCTTTATCTCTGATCTGG - Intronic
986903053 5:12460717-12460739 ATTAGTCTGTGTCTGTGAACTGG - Intergenic
988246838 5:28695523-28695545 GATAATCTGTTACTCTAAGCAGG - Intergenic
988348892 5:30075089-30075111 AATAAACTGAATCCCTGAACAGG + Intergenic
988666611 5:33335777-33335799 AACAATCTTTTTCTATAAACTGG + Intergenic
989632684 5:43502613-43502635 AATTATCTGCTTCACTGGACAGG - Intronic
989666406 5:43859305-43859327 AATTAGTTGTTTCTTTGAACTGG + Intergenic
990707837 5:58549728-58549750 AAAAATCTGTTTCTCTCACTTGG + Intronic
992916963 5:81465469-81465491 AACAATTTTTTTCTCTGAACAGG + Intronic
993274993 5:85845891-85845913 ATTTATTTGTTTCTGTGAACAGG + Intergenic
994431614 5:99671949-99671971 AATATTCTGTAACTCTCAACAGG - Intergenic
994987990 5:106962467-106962489 AAAAATCTGTTTTTCTTAAGTGG + Intergenic
995819122 5:116207460-116207482 ATTCATCAGTTTCTCTCAACTGG + Intronic
996430075 5:123365432-123365454 AATACACTGTTACTCTGAACCGG + Intronic
997024847 5:130046798-130046820 AATAATCTGATTTTCTATACAGG - Intronic
1000182585 5:158826202-158826224 CATCATCTGTTTCTCTGGGCAGG - Intronic
1004003145 6:11614298-11614320 AAAAATCTGATTCTATGAAATGG + Intergenic
1004479081 6:16001603-16001625 AATGATTTGTTTGTTTGAACTGG + Intergenic
1004867132 6:19864927-19864949 AATAGTATTTTTCTCTTAACAGG + Intergenic
1005420930 6:25650080-25650102 AATGATATGTTTCTCTGGAGTGG - Intergenic
1007604228 6:43105251-43105273 AATATTCTTATTCTCTGTACAGG - Intronic
1007828598 6:44620700-44620722 AATAATGTCCTCCTCTGAACTGG - Intergenic
1008355650 6:50549451-50549473 AATAATATTTTTCTTTGAAATGG + Intergenic
1009573401 6:65419557-65419579 AATATTCTGTTTCTCTTGAATGG - Intronic
1010024970 6:71204484-71204506 CATAGTCTCTTTCTATGAACGGG + Intergenic
1010853416 6:80806344-80806366 ATTCATGTGTTTCTCTGAAAAGG + Intergenic
1011333796 6:86237793-86237815 AATTATATTTTTCTCTAAACTGG - Intergenic
1012670490 6:102039566-102039588 GATAATCTATTTATCTGAACTGG + Intronic
1013359959 6:109384528-109384550 AAAAAGCTGTCTCTCTGAAATGG - Intergenic
1014495975 6:122123302-122123324 AAAAATCCCTTTCTCTGAAAGGG - Intergenic
1014667025 6:124251198-124251220 AAAAATCTTTTTCTTTTAACTGG - Intronic
1017863133 6:158417699-158417721 AGTAGTCTTTTTCTCTGAGCTGG - Intronic
1021243406 7:18232730-18232752 AACAACCTGTGTCCCTGAACTGG - Intronic
1021653279 7:22852103-22852125 AATAATCTCTTCCTCTGATAAGG + Intergenic
1021763375 7:23923051-23923073 AATAATCTTTGTCTATAAACAGG - Intergenic
1022028230 7:26468218-26468240 AATTATATGTTGCTCTGACCTGG - Intergenic
1022182752 7:27938394-27938416 GAAAATCTGTTTCTCTGTCCTGG + Intronic
1022195246 7:28059322-28059344 GATAATCTTTGTCTCTTAACTGG + Intronic
1022376444 7:29816118-29816140 AATAAAGTGTTTCTCTGAGGTGG + Intronic
1022491850 7:30826795-30826817 AGTCATCTGCTTCTCAGAACAGG - Intronic
1023384359 7:39640864-39640886 AAAATTCTGTTTTGCTGAACTGG - Intronic
1024372307 7:48600292-48600314 AATAATTTGTGTCTTTGAATAGG + Intronic
1024799714 7:53062047-53062069 AATAATCTTTTACTCTGAGAGGG + Intergenic
1027350142 7:77303421-77303443 AAAAAGCTGTTTCTTTGAAAAGG - Intronic
1029013569 7:97289738-97289760 AAAAATTTCTTTCTCAGAACTGG - Intergenic
1029861743 7:103579855-103579877 AATACTCTGCATCTCTGCACGGG - Intronic
1030002282 7:105078466-105078488 AATAATCTGTTACTCTTCAGAGG - Intronic
1030226920 7:107163220-107163242 AATAATCTTATTCTCTGCATTGG - Intergenic
1030286460 7:107831911-107831933 GATATTCCGTTTCTCTGAAGAGG - Intergenic
1033822345 7:145149466-145149488 AACATTCTGTTTCTTTTAACTGG + Intergenic
1033912305 7:146279472-146279494 ACTAATCAGTTTCTGTGAACAGG + Intronic
1034082472 7:148292325-148292347 ATTAATCTGAATATCTGAACTGG - Intronic
1036929964 8:12946620-12946642 AAAATTCTGTTTCTCTGAATTGG - Intronic
1037268762 8:17101392-17101414 AGTACTCTGTTTCACTGAATGGG + Intronic
1037679595 8:21085672-21085694 AAGAGCCTGTTTCTCTGAGCTGG + Intergenic
1038875815 8:31547887-31547909 AATAATATGTTTCTCAGAAGTGG - Intergenic
1040132808 8:43816902-43816924 AATAATCTGTTTTTCTCCACAGG - Intergenic
1040346592 8:46506389-46506411 AATATTCGGTTTCTCTCAATAGG + Intergenic
1042232863 8:66576522-66576544 CATAATCTGTTCCTCTTAAATGG - Intronic
1044449353 8:92315496-92315518 AATAAGCTGTTCCTATGAAATGG - Intergenic
1045574661 8:103407515-103407537 TTTAATCAGTTTCTCTGAATTGG - Intronic
1047702133 8:127459449-127459471 AATGTTCTGTTTCTTTGACCTGG + Intergenic
1048924799 8:139261808-139261830 AATTCTCTATTTCTCTGAATGGG - Intergenic
1049331089 8:142053087-142053109 AATGATCTATTTCTTTGAAAAGG - Intergenic
1050050421 9:1595479-1595501 ATTAATCTGTTTCTCTCCAAAGG + Intergenic
1050683143 9:8137465-8137487 AATTCTCAGTTTCTCTGAAAAGG - Intergenic
1050797429 9:9561718-9561740 AAAAATCTGTTTCTCTTCAGAGG + Intronic
1051150111 9:14070989-14071011 ACTCTTCTATTTCTCTGAACTGG - Intergenic
1051861104 9:21625873-21625895 AATAACCTGTGTTTCTTAACTGG - Intergenic
1052472156 9:28913293-28913315 AAAATTCTATTTCACTGAACAGG - Intergenic
1052548509 9:29913302-29913324 AATAATTTGTTTCTTTTCACTGG + Intergenic
1052566154 9:30154669-30154691 AATAATCTCTGTCTTTTAACTGG + Intergenic
1055740553 9:79383520-79383542 AAGAACCTGTTTCTGTGAAAAGG + Intergenic
1058324549 9:103679511-103679533 AAAAATATGTATCTCTGAACAGG - Intergenic
1058654847 9:107210865-107210887 AATAGCCTTTTTCTCTGACCTGG - Intergenic
1059618950 9:115982260-115982282 AATATTCTGTGTCACTGATCAGG + Intergenic
1061639328 9:131939513-131939535 ATTAATCTGTAGCTCTTAACTGG - Intronic
1062259333 9:135652413-135652435 AATAATGTGTTTTTATGAAAAGG + Intergenic
1185525648 X:776523-776545 AATCATCTGTTTATCCGAAAAGG + Intergenic
1186485254 X:9929714-9929736 AATTATCTGTTTCTGTGATGTGG + Intronic
1187411758 X:19056775-19056797 AATAATCTGTAACTCTGATTTGG + Intronic
1188057222 X:25555238-25555260 ACATATCTGTTTCTCTGACCCGG - Intergenic
1188342596 X:29022664-29022686 AATAAAATATTTCTCTGAAAAGG + Intronic
1191965512 X:66752854-66752876 ACTAGTCTGTTTCTCTGGCCAGG + Intergenic
1192118384 X:68432828-68432850 GATGAGCTGTTTCTCTGAGCTGG - Intronic
1193916295 X:87368786-87368808 AGGAATCTGTTAATCTGAACTGG - Intergenic
1194180183 X:90701663-90701685 AAGAATTTGATTCCCTGAACAGG + Intergenic
1194878293 X:99218094-99218116 ACTAATTTCTTTCTCTTAACTGG - Intergenic
1195983253 X:110602031-110602053 ATTTATGTTTTTCTCTGAACTGG - Intergenic
1196195995 X:112839427-112839449 AATTATCTTCTTCTCTGAATGGG + Intronic
1196710696 X:118759028-118759050 AATAATCTGTCTCTTAGAAAAGG + Intronic
1199697152 X:150350897-150350919 AATGAACTGTGTCTCAGAACTGG + Intergenic
1200526840 Y:4283825-4283847 AAGAATTTGATTCCCTGAACAGG + Intergenic
1200886695 Y:8279009-8279031 TATTTTCTGTTTCTCTGGACAGG - Intergenic
1201853584 Y:18516342-18516364 AATAATCTGTATGTCTTTACTGG - Intergenic
1201879737 Y:18804042-18804064 AATAATCTGTATGTCTTTACTGG + Intronic
1202109249 Y:21404628-21404650 TATTTTCTGTTTCTCTGGACAGG - Intergenic
1202161228 Y:21939002-21939024 TATTTTCTGTTTCTCTGGACAGG - Intergenic
1202230128 Y:22647371-22647393 TATTTTCTGTTTCTCTGGACAGG + Intergenic
1202313028 Y:23548794-23548816 TATTTTCTGTTTCTCTGGACAGG - Intergenic
1202557774 Y:26121800-26121822 TATTTTCTGTTTCTCTGGACAGG + Intergenic