ID: 967359311

View in Genome Browser
Species Human (GRCh38)
Location 3:188611488-188611510
Sequence ATTGTTGAAAACAAAAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 580}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967359311_967359316 24 Left 967359311 3:188611488-188611510 CCACAGTTTTTGTTTTCAACAAT 0: 1
1: 0
2: 8
3: 46
4: 580
Right 967359316 3:188611535-188611557 TTACAGTAAAATAAAATTTTAGG 0: 1
1: 0
2: 9
3: 135
4: 1274
967359311_967359312 -4 Left 967359311 3:188611488-188611510 CCACAGTTTTTGTTTTCAACAAT 0: 1
1: 0
2: 8
3: 46
4: 580
Right 967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG 0: 1
1: 0
2: 1
3: 10
4: 109
967359311_967359313 -3 Left 967359311 3:188611488-188611510 CCACAGTTTTTGTTTTCAACAAT 0: 1
1: 0
2: 8
3: 46
4: 580
Right 967359313 3:188611508-188611530 AATTGCAACAGATTTACCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967359311 Original CRISPR ATTGTTGAAAACAAAAACTG TGG (reversed) Intronic
900788063 1:4661948-4661970 TTTCTTGAAATTAAAAACTGTGG + Intronic
901030167 1:6302529-6302551 ATTTGTGAAAACACAGACTGGGG - Intronic
901725306 1:11237258-11237280 GTAGGTGAAGACAAAAACTGAGG + Intronic
902042887 1:13505444-13505466 TTTGCTGAAAACAAAAACAAAGG + Intronic
902831432 1:19015792-19015814 TTTGTTGAAAACACAAATTTGGG - Intergenic
904497954 1:30898066-30898088 ACTGTTCAGAACAAGAACTGAGG + Intronic
905975243 1:42169432-42169454 ATTTTTTAAAGCAGAAACTGAGG - Intergenic
906211653 1:44015659-44015681 ATAGGAGAGAACAAAAACTGAGG - Intronic
906372289 1:45264347-45264369 ATAGGAGAAAACATAAACTGTGG + Intronic
906591478 1:47028868-47028890 ATTGTTGAAAACCACTACTCTGG + Intronic
906842480 1:49154572-49154594 AGTCTAGAAAACACAAACTGTGG + Intronic
906984576 1:50669551-50669573 ATAGTTGATAAAAAAAATTGGGG + Intronic
907291488 1:53415869-53415891 ATTGAGGAAAACAAAAACCCAGG + Intergenic
907494483 1:54834164-54834186 AGTTTTCCAAACAAAAACTGTGG - Intronic
909320692 1:74281467-74281489 ATAGTTGTAAAGAAAAAATGTGG + Intronic
909473785 1:76059294-76059316 ATTGTTAAAAACAAAAAATGAGG + Intergenic
909571169 1:77112540-77112562 ATTGATAAAAGCAAAAAGTGAGG - Intronic
910168838 1:84356711-84356733 ATAGTTAAAAAGGAAAACTGTGG + Intronic
910499022 1:87867441-87867463 TTTGCAGAAATCAAAAACTGAGG + Intergenic
911886897 1:103313267-103313289 ATTTTGGAAAACAAAAACTGAGG + Intergenic
912254589 1:108046090-108046112 ACTGTTTATAATAAAAACTGTGG - Intergenic
912569249 1:110609263-110609285 CTTCTTGAAAACAGAAGCTGTGG + Intronic
913548322 1:119892461-119892483 ATTTTAGAAAAGAGAAACTGAGG - Intergenic
914768994 1:150666690-150666712 ATTGTTGAAATCAAAATCTCAGG - Intronic
915813935 1:158947403-158947425 ATAGTTTAAAATAAAACCTGAGG - Intronic
916230642 1:162537908-162537930 ATTGTTAGAAACAAAAAGTATGG - Intergenic
916601742 1:166299796-166299818 ATTTTTAGAAATAAAAACTGTGG + Intergenic
917254347 1:173098403-173098425 ATTGCTGAAAAAAAAAATGGAGG + Intergenic
917266462 1:173225841-173225863 ATTCTTGAACACAGAGACTGTGG + Intergenic
920125566 1:203691493-203691515 TTTTTTGAAAACAGCAACTGTGG - Intronic
920628999 1:207633289-207633311 ATTGTTAAAAACAAGAAATAGGG + Intronic
920889346 1:209968593-209968615 ATTCTGGAAAAGAAAAACTATGG - Intronic
921743758 1:218714791-218714813 AACGTTGAAAACAAAAAGTCAGG + Intergenic
921819327 1:219598988-219599010 ATTATTGAATATAATAACTGTGG - Intergenic
922131600 1:222785883-222785905 ATTTTTGAAAATAAAAAATTGGG - Intergenic
922216859 1:223526819-223526841 CTTCTTGAAAACAAAAACTGAGG + Intergenic
922287895 1:224185069-224185091 AATGTTGAGAAGAAAAACTAAGG - Intronic
923344210 1:233035294-233035316 ATTATTGGGAACAAAAACTGCGG - Intronic
924601710 1:245495780-245495802 ACTGTTGAAAACAAAAGCCAAGG + Intronic
924679208 1:246214527-246214549 ATTGTTTAAAATAAAAACCAAGG + Intronic
1063110410 10:3031351-3031373 ACTGTTGAAAACAATCACTTAGG - Intergenic
1063433208 10:6009047-6009069 GTTTTTGAAAACAAAAATTCAGG + Intergenic
1063868230 10:10390008-10390030 ATTGTCGAGAACAAATAGTGTGG + Intergenic
1064488238 10:15820130-15820152 ATTGTGGAAAAGAATATCTGAGG + Intronic
1064863054 10:19848304-19848326 ACAGATGACAACAAAAACTGAGG - Intronic
1065539589 10:26749222-26749244 ATTCTTTAAAAAAAAATCTGGGG - Intronic
1066083025 10:31950735-31950757 ATTTTTAAAAATAAAAACTTGGG + Intergenic
1066304148 10:34123423-34123445 AATGTTTAAAAAAAAAACTGTGG - Intronic
1067976600 10:51032852-51032874 ATTTTTAAAAATAAAAATTGTGG + Intronic
1068530211 10:58177216-58177238 ATTGTAGAAAGTAAAGACTGTGG - Intergenic
1068806413 10:61199263-61199285 ATTGTTGAAAAAAAAAATCCAGG - Intergenic
1068919814 10:62471454-62471476 TCTATTGAAAACAAAAACTGAGG + Intronic
1070292326 10:75125971-75125993 AAAGTTGAAAATATAAACTGGGG - Intronic
1070481475 10:76887196-76887218 TTTGTTGGAAACACCAACTGGGG + Exonic
1070700679 10:78599587-78599609 TATTTTGAAAACAGAAACTGTGG + Intergenic
1071949505 10:90686907-90686929 ATCTTTGATAACACAAACTGTGG - Intergenic
1072326016 10:94299560-94299582 ACTGTTCAAAGGAAAAACTGTGG - Intronic
1072354853 10:94598292-94598314 TTTGTTAAAAACAAAGACTGGGG - Intronic
1072865480 10:99056016-99056038 ATTCTTTAAAAGAAAAACTTTGG - Intronic
1073809395 10:107136111-107136133 GTTGTAGAAAAAAAAAATTGGGG + Intronic
1073909989 10:108330741-108330763 CTTTTTGATAATAAAAACTGAGG - Intergenic
1074120593 10:110491317-110491339 ATTTTAGAAAACAGAAAGTGAGG + Intergenic
1074239876 10:111627648-111627670 ATTATTTAAAAAAAAAACAGTGG + Intergenic
1075319208 10:121476557-121476579 AGTTTTGAAAACAAGAAATGGGG - Intergenic
1077271256 11:1683055-1683077 ATTGTTGCAAACAGAAACCACGG + Intergenic
1077340154 11:2022786-2022808 ACTGTTGGAGACAAATACTGAGG + Intergenic
1078038019 11:7828237-7828259 AATGTTCAAAACCAATACTGAGG + Intergenic
1078279320 11:9884061-9884083 GTAGTTGAAAACAAAATCTCTGG - Intronic
1078312303 11:10257173-10257195 ATTGTTAAAAACATGAACTTTGG - Intronic
1078570492 11:12453593-12453615 ATAGATTAAAACAGAAACTGAGG + Intronic
1078969014 11:16384546-16384568 ATTGTTGCAAGCAAAGACAGAGG - Intronic
1079508794 11:21185645-21185667 AATTTTGAAAACTAAAACCGAGG - Intronic
1079537221 11:21528518-21528540 ATTGTGGAAAAAAAAAAAGGGGG - Intronic
1079583194 11:22092091-22092113 ATAATTTAAAACAATAACTGTGG + Intergenic
1079593121 11:22205666-22205688 ATCATTGAAACCAAAAGCTGTGG + Intronic
1079755652 11:24257359-24257381 ATTTTTGAAAAGAAAAACTGGGG - Intergenic
1081150427 11:39622304-39622326 ATATTTGAAAACAAAATGTGAGG - Intergenic
1082036554 11:47649881-47649903 TGTGTTGAAAACAATGACTGAGG - Intergenic
1084023763 11:66434976-66434998 CTTTTTGAAAAAACAAACTGGGG - Intergenic
1084585160 11:70056444-70056466 ATTGGTGAAAACAAAAAAAAGGG - Intergenic
1085424622 11:76393171-76393193 ATTGTAGAATACATAAAATGAGG + Intronic
1085766338 11:79286339-79286361 CTTATAGAAAACAAAAATTGAGG - Intronic
1087719808 11:101650232-101650254 ATTGGTGGAAACACACACTGGGG + Intronic
1087725778 11:101714601-101714623 ATTGTAGAAAACAAAAATTAAGG + Intronic
1087760496 11:102099932-102099954 ATTGTTTAGAAAAAAGACTGAGG + Intergenic
1088168129 11:106962728-106962750 ATTGTTGCATAAAAATACTGAGG - Intronic
1088223719 11:107595484-107595506 CTTGCTGAAAACAAAACCTATGG - Intronic
1088420954 11:109646226-109646248 ATTCTTGAAAACAAAGAATCAGG + Intergenic
1088872767 11:113905944-113905966 ATTGTAAAAAATAAAAACAGAGG + Intronic
1089071719 11:115705360-115705382 AATTTTAAAAACAAAAATTGAGG + Intergenic
1089309904 11:117551201-117551223 ATTGGTGCAAACAAAAAGTTTGG + Intronic
1090057627 11:123437289-123437311 ATTGTTCAGAACCCAAACTGAGG + Intergenic
1090061252 11:123465973-123465995 ATTGTTGAAAATAAAGATTTGGG + Intergenic
1090112563 11:123929713-123929735 TTTGTAGATAACAAAAATTGAGG - Intergenic
1090478614 11:127047773-127047795 AATTTTCAAAACAAAAACTTGGG + Intergenic
1091093924 11:132799667-132799689 ACTGTTGAAAAGAAAAATGGTGG + Intronic
1202823139 11_KI270721v1_random:77975-77997 ACTGTTGGAGACAAATACTGAGG + Intergenic
1091461909 12:649979-650001 ATTATTCATAACAAAAAATGGGG - Intronic
1092326875 12:7542084-7542106 AATATTCAAAACAGAAACTGAGG + Intergenic
1093088434 12:14892800-14892822 ATTGTTGAAAACCAAAGCAGAGG + Intronic
1093129227 12:15369716-15369738 ATTCTTAAAAATGAAAACTGAGG + Intronic
1093168248 12:15829985-15830007 ACTCTGGAAAAGAAAAACTGTGG - Intronic
1093357281 12:18181267-18181289 TTTTTTGAAAACAAAATTTGAGG + Intronic
1093656475 12:21700265-21700287 CTTGTGGATAACAAAATCTGTGG + Intronic
1093745459 12:22735831-22735853 ATTTTTAAAAACAAAAAATTGGG - Intergenic
1094705195 12:32907895-32907917 CATACTGAAAACAAAAACTGGGG + Intergenic
1095166524 12:38979997-38980019 ATTGTGGAAAAACAAAAATGGGG - Intergenic
1095391235 12:41709089-41709111 ACAGTTGAAAAGTAAAACTGTGG - Intergenic
1096034518 12:48454014-48454036 ATTGTTGAAAAATAAATCAGGGG + Intergenic
1096949171 12:55446695-55446717 AGTGTGGAGAACAAAAGCTGTGG + Intergenic
1097846795 12:64374836-64374858 AAAGTTGAAAATAAAGACTGGGG - Intronic
1098701800 12:73637932-73637954 ATTGTCAAAAACAAGAAATGGGG + Intergenic
1098938396 12:76506532-76506554 AAAGTTGAAAACAAAAAATCAGG - Intronic
1099006714 12:77242745-77242767 ATTTTTCAAAACAAAAAATCTGG - Intergenic
1099359748 12:81685412-81685434 ATTCTTTAAAACAAAAAAAGGGG + Intronic
1099789013 12:87306503-87306525 GTTATTGAAAAAAAAAACAGTGG - Intergenic
1100015117 12:90000400-90000422 CTTGCTGAAAACAAAAACAATGG + Intergenic
1100273413 12:93047932-93047954 TTTGTTGAAAATGAAGACTGAGG - Intergenic
1101261478 12:103035863-103035885 ACTGATGAAAACCAAAACTAAGG - Intergenic
1101350842 12:103929158-103929180 ATATTTGAAAGCAAAACCTGTGG - Intergenic
1101365035 12:104063691-104063713 GGTGTTGAAAAAAAAGACTGGGG - Intronic
1102036731 12:109774860-109774882 ATAGGTGGAAACAAAAACTTAGG - Intergenic
1102732834 12:115128646-115128668 ATTGTTGAAAACTGAAAATAAGG - Intergenic
1106987077 13:35366699-35366721 ATTCAGGAAAAAAAAAACTGAGG + Intronic
1107588611 13:41880389-41880411 TTTCCTGAAAACAAGAACTGTGG + Intronic
1108008429 13:45976737-45976759 ATTTTTGAAAGCAACTACTGCGG + Intronic
1108364485 13:49696176-49696198 ATTATTAAAAACAGAAACTATGG - Intergenic
1108841390 13:54620943-54620965 ATCTATGAAAAAAAAAACTGGGG - Intergenic
1108954322 13:56133604-56133626 AATTTTGAAAACAAAAACTGAGG + Intergenic
1108975271 13:56434654-56434676 AAGGTTGAAAACAAAATCTGAGG + Intergenic
1109288550 13:60442941-60442963 ATTGATGAAAACCAGAAATGAGG + Intronic
1109433593 13:62269202-62269224 AATATCAAAAACAAAAACTGAGG + Intergenic
1109453873 13:62556890-62556912 ATTATAGAAAAGAAAAACTATGG + Intergenic
1110162018 13:72389599-72389621 ATTTTTTAAAAAAATAACTGGGG + Intergenic
1110376294 13:74797675-74797697 TTTGCTTAAAACAAAAACTAAGG + Intergenic
1111518398 13:89364872-89364894 ATGTATGAAAAGAAAAACTGAGG - Intergenic
1111552397 13:89831458-89831480 CATTTTAAAAACAAAAACTGAGG - Intergenic
1111663308 13:91237584-91237606 ATTGTTGAGAACAATGGCTGGGG - Intergenic
1111695727 13:91621471-91621493 ATTCTTGAAAAGAAATCCTGGGG - Intronic
1111829024 13:93303234-93303256 ACTGTTGAAAAGGTAAACTGAGG - Intronic
1111849226 13:93551195-93551217 ATTGTTGAAAATAAAATCAATGG - Intronic
1112034934 13:95488340-95488362 ATTGTTAAAAAAAAAATTTGAGG - Intronic
1112289204 13:98130215-98130237 AGTGTTGAAAAGAACAATTGTGG + Intergenic
1112535051 13:100245624-100245646 ATTGATGATTACCAAAACTGAGG - Intronic
1112792243 13:103015781-103015803 TTTGTCGAAAAGAAAAATTGAGG - Intergenic
1112809919 13:103206079-103206101 ATAGTTAAAAAAAAAAAATGTGG - Intergenic
1113119960 13:106915685-106915707 ATTGCTGAAAACAAAAATCGAGG + Intergenic
1113186198 13:107688294-107688316 ATTGTTGGGAACACAAACTCTGG - Intronic
1113221260 13:108105630-108105652 TTTGTATAAAATAAAAACTGTGG + Intergenic
1113362891 13:109647428-109647450 AGTCTTTAAACCAAAAACTGTGG + Intergenic
1114219844 14:20686330-20686352 ATTGTTGAAAACAGATAATCAGG + Intronic
1114956600 14:27827802-27827824 ATGGTTAAAAAAAAAAAGTGAGG - Intergenic
1115449637 14:33531556-33531578 ATGGTTGAACAGAAAAACTGTGG - Intronic
1116112475 14:40604591-40604613 ATTGTGGAAAAAGAAATCTGTGG - Intergenic
1116408030 14:44589693-44589715 ATTGTTAAAAACTAAAACCCAGG + Intergenic
1117085670 14:52197649-52197671 ATAGGTGAAAAGATAAACTGTGG + Intergenic
1117705627 14:58464387-58464409 ATTATTAAAAACTAAAACTTTGG + Intronic
1118066248 14:62193819-62193841 ATAGGTGAATACATAAACTGTGG - Intergenic
1118152909 14:63208973-63208995 GTTTCTGAAAACAAAAACTTTGG + Intronic
1119242960 14:73077472-73077494 AATGTTGCCAACAAAAACAGTGG - Exonic
1119460339 14:74797473-74797495 ATTGTTGTAAACAAATTCTAAGG + Intronic
1120125251 14:80734546-80734568 ACTGTTTAAAACAATAACTGAGG + Intronic
1120230781 14:81838312-81838334 ACTTTTGAAAAAAAAAACTAAGG - Intergenic
1120360697 14:83498206-83498228 ATTACTGAAAAATAAAACTGAGG + Intergenic
1121300937 14:92870381-92870403 ATTTTTGAATAAACAAACTGTGG + Intergenic
1121301135 14:92872162-92872184 ATTTTTGAATAAATAAACTGTGG + Intergenic
1121301270 14:92873312-92873334 ATTTTTGAATAAACAAACTGTGG + Intergenic
1121704902 14:95984230-95984252 CTTGATGAAAACAGAAATTGAGG + Intergenic
1122570624 14:102697054-102697076 ATTAAAGAAAACAAAAGCTGAGG + Intronic
1123204871 14:106702633-106702655 GATGTAGAAAACAAAAAATGGGG + Intergenic
1123209873 14:106749074-106749096 GATGTAGAAAACAAAAAATGGGG + Intergenic
1123433394 15:20237232-20237254 ATTGATCAAGCCAAAAACTGAGG + Intergenic
1124801216 15:32834651-32834673 ATTGCTGAAAATAATAACGGTGG - Intronic
1125299110 15:38235445-38235467 ATTGTTCAAAATATATACTGAGG - Intergenic
1125871052 15:43102127-43102149 AATGCTTAAACCAAAAACTGAGG + Intronic
1127079084 15:55358032-55358054 ATACTTGAACACAAACACTGTGG - Intronic
1127477637 15:59349659-59349681 TTTCTGCAAAACAAAAACTGAGG + Intronic
1127926009 15:63543218-63543240 CATTTTGAAGACAAAAACTGAGG - Intronic
1127953203 15:63830425-63830447 GTCGTGAAAAACAAAAACTGAGG + Intronic
1129357766 15:75003467-75003489 ATTTTTCAAAATAAAAAGTGGGG - Intronic
1129384201 15:75186545-75186567 ATTCTTTAAAAAAAAAAATGAGG - Intergenic
1129794694 15:78367258-78367280 ATTTTTAAAAACACATACTGAGG + Intergenic
1130181425 15:81632941-81632963 ATTTTTAAAAACAAAATTTGTGG - Intergenic
1130547515 15:84867917-84867939 TTTTTTAAAAAGAAAAACTGAGG + Intronic
1131966271 15:97847348-97847370 ATTTTTGAAAAAAAAAACAGTGG - Intergenic
1132083398 15:98886156-98886178 ATTATTTAAAAAAAAAACTCTGG + Intronic
1132435295 15:101796066-101796088 ATTGATGAAGATAAAAAATGTGG + Intergenic
1133689157 16:8196328-8196350 ATTGTAGAAAACCAAGACAGAGG - Intergenic
1133795341 16:9041901-9041923 TTTGTTAAAAACAAAAACACAGG - Intergenic
1134019647 16:10912688-10912710 ATGTCTGAAAACAATAACTGAGG + Intronic
1135108020 16:19667801-19667823 AGCGTTGACAACATAAACTGTGG - Intronic
1135849566 16:25950923-25950945 ATTATTGAAAACATAGTCTGTGG + Intronic
1135907870 16:26529956-26529978 ATTGTTGGAAACAAAACCAGAGG + Intergenic
1136404410 16:30035701-30035723 AGTGTTTAAAACAAAAAATTGGG - Intronic
1136851231 16:33613896-33613918 ATTGATCAAGCCAAAAACTGAGG - Intergenic
1137910459 16:52373002-52373024 ATTGCTATAAACAAAATCTGAGG + Intergenic
1138150528 16:54652458-54652480 AATGATAAAAACAAAAACTCTGG + Intergenic
1140806872 16:78540691-78540713 TTTGTTAAAAAAAAAAAATGGGG + Intronic
1141209277 16:81961097-81961119 TTTGTTGAAAGCAAAAAATTTGG - Exonic
1141270675 16:82538402-82538424 ATTGTTGAAGTAAAAAATTGTGG + Intergenic
1203112835 16_KI270728v1_random:1462357-1462379 ATTGATCAAGCCAAAAACTGAGG - Intergenic
1142822618 17:2483144-2483166 ACTGTTTTAAACAAAAACTACGG + Intronic
1143843050 17:9749985-9750007 AGTGTTGAAAACAAAAAAGGGGG - Intergenic
1147220659 17:38927686-38927708 ATGTTTTAAAACAAAAATTGAGG + Intergenic
1147231481 17:39022207-39022229 ATTGTTGCCAGCAAGAACTGTGG + Intergenic
1147860887 17:43522426-43522448 CTAGTTGAAAAAAAAAATTGTGG + Intronic
1148300463 17:46543798-46543820 AATGTTTAAAATAAAAACTTGGG + Intronic
1148364602 17:47044693-47044715 AATGTTTAAAATAAAAACTTGGG + Intronic
1149712145 17:58753353-58753375 ATTGTTGAAATGTAAAATTGTGG + Intergenic
1151667736 17:75555376-75555398 ATGTTTAAGAACAAAAACTGAGG - Intronic
1153398123 18:4648706-4648728 ATTATTAAAAACAAAAACACAGG - Intergenic
1153674322 18:7442778-7442800 ATTGTTGGAGACAGACACTGGGG + Intergenic
1153741709 18:8137159-8137181 ACTGCTGAAAAGAAAAGCTGAGG - Intronic
1153874133 18:9351120-9351142 ATATTTAAAAACACAAACTGAGG - Intronic
1155303596 18:24456565-24456587 ATTATTGAAAAGAAAAATAGAGG + Intergenic
1155384567 18:25263322-25263344 ATTGATGAAAAAAAAAAGTTAGG + Intronic
1155862798 18:30924843-30924865 ATTATGGAAAACTAAAAGTGTGG - Intergenic
1156172088 18:34497678-34497700 ATTGTTTAAAAAAAAAAAAGTGG + Intronic
1156317357 18:35982775-35982797 ACTGTTGAATAAAAAAAATGTGG + Intergenic
1156606450 18:38672375-38672397 ATTGGTGACAAAAAAATCTGGGG + Intergenic
1156682991 18:39613684-39613706 AGAGTTGAAAACAAAATTTGGGG - Intergenic
1157625692 18:49048982-49049004 AATGTTGCAAACAAAATCTCAGG + Intronic
1158923326 18:62220592-62220614 ATTCTTAAAAAGAAAAACTTAGG - Intronic
1159097009 18:63914648-63914670 ATTGATGAAGACTACAACTGAGG - Intronic
1159498057 18:69231458-69231480 ATAGATGAAAACAAAAGCTTAGG - Intergenic
1159549678 18:69881372-69881394 TTTATTGAAAACAGAGACTGAGG + Intronic
1159729386 18:72006123-72006145 ATAGTAAAAAACAAAAACAGTGG + Intergenic
1160463468 18:79056778-79056800 ATTTTTGCAAACAAAATCTGTGG + Intergenic
1160654471 19:256715-256737 ATTGTTGGAAACCCAAACTCTGG + Intergenic
1161040397 19:2107981-2108003 ACTGTTAAAACAAAAAACTGAGG + Intronic
1162015392 19:7844045-7844067 ATTTTTAAAATCAGAAACTGAGG + Intronic
1165029596 19:32988292-32988314 ATTGATCAAGCCAAAAACTGAGG + Intronic
1165981395 19:39727240-39727262 AGTGCTGAAAACAAGACCTGAGG + Intergenic
1166027028 19:40096000-40096022 ATTTTTGCAAACAAAAATTCTGG + Intergenic
1166281775 19:41798852-41798874 CTTATTGAAAAAAAAAATTGAGG + Intronic
1166462645 19:43002905-43002927 ATTAAAAAAAACAAAAACTGAGG - Intronic
925053086 2:832335-832357 ATGGTTGAAAATAAAAGCTTGGG - Intergenic
925350375 2:3197113-3197135 ATTATTGAAAATAATTACTGAGG + Intronic
925590708 2:5507068-5507090 ATTGTTGAGAAAACAAAGTGGGG - Intergenic
926080680 2:9983854-9983876 AGTGTTTAAAAAAAAAAATGTGG + Intronic
926554380 2:14340710-14340732 ACTGTGGATAACTAAAACTGTGG - Intergenic
926589655 2:14726867-14726889 ATTCATGAATATAAAAACTGAGG - Intergenic
927001738 2:18802623-18802645 ATTATTCAAAACAAAAAATTAGG - Intergenic
927562392 2:24083232-24083254 ATTTTTGAAAAAAAAAAGAGGGG - Intronic
927796647 2:26055077-26055099 TTTATTGAAAAAAAAAATTGAGG + Intronic
928039263 2:27857976-27857998 ATTGATGAATAAAAAAATTGTGG + Intronic
928342596 2:30458038-30458060 ATTGTTAAAAAAAAAAAAAGAGG + Intronic
928956842 2:36877833-36877855 GTTTTTAAAAACAAAAACTTGGG - Intronic
928957570 2:36886642-36886664 AACATTGAAAAAAAAAACTGGGG + Intronic
929335671 2:40741907-40741929 ATCCTTGAAAAAAAAAATTGTGG - Intergenic
930460072 2:51662769-51662791 ATTATGAAAAAGAAAAACTGCGG + Intergenic
930562287 2:52974842-52974864 ATTGTTTAAATCAAGAATTGGGG + Intergenic
930809764 2:55528151-55528173 ATTCTATAAAACAAAAATTGTGG - Intronic
931444352 2:62314355-62314377 TTAGATGAAAAAAAAAACTGAGG + Intergenic
933098374 2:78217546-78217568 ATTTTTGGAAAAAAAAATTGAGG + Intergenic
933797816 2:85935108-85935130 ATAATTCAAAACAATAACTGTGG - Intergenic
933894759 2:86800718-86800740 TTTGTTGAAAGCAAACACTTGGG - Intronic
934031527 2:88052930-88052952 AATGTTGAAAATAATAAATGTGG - Intronic
936269860 2:111041377-111041399 ATTTTGGGAAACAAACACTGTGG - Intronic
936670339 2:114649138-114649160 CTTTTTAAAAATAAAAACTGTGG + Intronic
936724742 2:115299776-115299798 AATTTTGAAAACAATATCTGTGG - Intronic
936743132 2:115539213-115539235 ATTGTGGAAAAGGAAAACTCTGG + Intronic
937830632 2:126418730-126418752 TTTTTTAAAAACAAAAATTGAGG - Intergenic
939285050 2:140118268-140118290 GCTGTTGAAACCAAAGACTGAGG - Intergenic
939592232 2:144079764-144079786 ATTGTTGAAAAATAAAACTATGG + Intronic
939863967 2:147451997-147452019 ATAATTGAAAACAAAAACAACGG - Intergenic
939895811 2:147790307-147790329 ATTGTTCAAAAAAAAAATTACGG - Intergenic
940514986 2:154672108-154672130 AGTTTTGAAAACCAAAAATGTGG - Intergenic
941831647 2:169967558-169967580 ATTTTTGTCAACAAAAATTGAGG + Intronic
942894212 2:181032051-181032073 AATCTAGAAACCAAAAACTGTGG + Intronic
944372308 2:198999158-198999180 ATTGATGAAAAGAAGAATTGAGG + Intergenic
945414229 2:209551303-209551325 ACTGATGAAAATAAAAAGTGAGG - Intronic
945472631 2:210245252-210245274 ACTGGTTAAAACAAAGACTGGGG - Intergenic
945876441 2:215282982-215283004 GTTTTTTAAAACAAAAAGTGGGG + Intergenic
946267386 2:218558265-218558287 ATTATTGAAAAGAAAACTTGTGG - Intronic
946274017 2:218617274-218617296 ATTTTTAAATACAAAAAATGCGG + Intronic
946344558 2:219098366-219098388 CTTATAGAAAACAAAAACTTAGG + Intronic
946753108 2:222913506-222913528 ATTGTTGAAGCCAAAAAATCAGG + Intronic
946971298 2:225094752-225094774 ATGAATGAATACAAAAACTGTGG + Intergenic
948116631 2:235498270-235498292 AATGTACAAAACAAAAATTGGGG - Intronic
948876060 2:240829677-240829699 ATTTGTGAAAACAAAACCTTAGG + Intergenic
1168884650 20:1239838-1239860 ATTGTGGCAAATAAAAAATGGGG - Intronic
1169047565 20:2546716-2546738 TTTGTTGAAGACAAAAACTCTGG + Intronic
1169478308 20:5952432-5952454 TTTGTTGAAAGCAAAAACTGTGG - Exonic
1169662850 20:7999313-7999335 TATGTGGAAAACAAAACCTGTGG - Intronic
1170016170 20:11784916-11784938 ATTTTTGACAACAAAGATTGGGG - Intergenic
1170386729 20:15826854-15826876 ATTTTTAATAACAAAAAATGTGG + Intronic
1172338821 20:34139354-34139376 AATTTGGCAAACAAAAACTGAGG + Intergenic
1173029015 20:39337211-39337233 ATTGTTGAACACTTAAAATGTGG + Intergenic
1173426667 20:42949088-42949110 ATTGCTAAAAACAGAAACTTGGG + Intronic
1173511168 20:43629631-43629653 ATTGTTGTAAACAGTAAATGTGG - Intronic
1173921155 20:46746332-46746354 ATTGTTCAGATCAAAAACTTTGG + Intergenic
1174750558 20:53107231-53107253 ATGGTTGAGAACATAAACTCTGG + Intronic
1174752227 20:53122941-53122963 ACTTTTGGAAATAAAAACTGGGG + Intronic
1174864275 20:54120452-54120474 ATTTTTGAAACTACAAACTGGGG + Intergenic
1174982510 20:55412168-55412190 AATCTTGAAAACAAAAAATAAGG + Intergenic
1175324968 20:58117782-58117804 ACTTTTGTAAATAAAAACTGAGG + Intergenic
1176005434 20:62860214-62860236 ATTAGTGAAAAATAAAACTGCGG - Exonic
1176012218 20:62904140-62904162 AGTGAAGAAAAGAAAAACTGCGG - Intronic
1177323205 21:19548287-19548309 ATTGTTGAAAGAAAAAACATAGG - Intergenic
1177488977 21:21796734-21796756 AAAGAAGAAAACAAAAACTGAGG + Intergenic
1177952567 21:27556887-27556909 ATTATTAAAAAAAAAAAGTGAGG - Intergenic
1178025184 21:28458095-28458117 ATTTTTGAAAAGAAATAATGTGG - Intergenic
1178183624 21:30193604-30193626 ATTATTGAAAACAACAGATGAGG - Intergenic
1178456375 21:32756659-32756681 ATGGTTTAAAAAAAAAAATGAGG - Intronic
1178687798 21:34724904-34724926 ATTGTTCACAAGAAAAACTTTGG + Intergenic
1181908954 22:26222571-26222593 ATTCTGGAGAAAAAAAACTGAGG + Intronic
1183130921 22:35835192-35835214 AATGTTGAAAAAAAAGAGTGAGG + Intronic
1184487598 22:44790294-44790316 CTAGCTGAAACCAAAAACTGGGG + Intronic
949096418 3:91523-91545 AAGGTTGAAAACAATATCTGAGG - Intergenic
950242019 3:11378976-11378998 AGTGTTGAAGACAAACGCTGTGG + Intronic
951062740 3:18228729-18228751 GGTGTTAAGAACAAAAACTGAGG - Intronic
951373226 3:21879248-21879270 ATTTATGAAAACAAACACTTTGG - Intronic
951402402 3:22249769-22249791 ACTGTTGAAAGCTAAAATTGTGG + Intronic
951663455 3:25096060-25096082 AATGTTGAAAAAAATAATTGTGG - Intergenic
952188882 3:31000955-31000977 ATGGTTGTAAACAGCAACTGTGG - Intergenic
952191081 3:31024172-31024194 ATAGGTAAAAACATAAACTGAGG - Intergenic
952220902 3:31323413-31323435 ATTATTAAAAACAAAAGCAGAGG + Intergenic
952832522 3:37576904-37576926 ATTTTTTAAAACAAGAATTGTGG - Intronic
953092840 3:39746835-39746857 ATAGTTTAAAACAATAGCTGAGG - Intergenic
953213312 3:40895565-40895587 ACTGTTGAGAACAAATACTATGG - Intergenic
954511398 3:51129051-51129073 ATTGGTGAAAAAGAAATCTGGGG - Intronic
954675618 3:52313878-52313900 ATTGTGCAGAAGAAAAACTGAGG + Intergenic
954854362 3:53630167-53630189 AATAATGAAAACAAAACCTGTGG - Intronic
955720070 3:61871023-61871045 ATTCTAGAAAAAAGAAACTGAGG - Intronic
955948167 3:64215052-64215074 ATTGTTTAAAAAACAAACGGTGG - Intronic
956717232 3:72088924-72088946 AATGTCGAAAACACAAACTTGGG - Intergenic
956865885 3:73368226-73368248 ATTATTGCAAACAGAAACAGAGG + Intergenic
956904540 3:73752298-73752320 ATTGTTGAAAGGATTAACTGAGG - Intergenic
957163842 3:76645089-76645111 ATAGGTGAAAAGAAAAACTAAGG + Intronic
957311902 3:78530848-78530870 ATTGTAGAAAAGAAAAATTATGG + Intergenic
957685291 3:83497490-83497512 AAGCTTGAAAACAAAAACAGAGG - Intergenic
957760283 3:84547543-84547565 ATTGCAGGAAAAAAAAACTGAGG - Intergenic
957813197 3:85255150-85255172 ATTGCTTAAAACAGAAACTTGGG + Intronic
959831464 3:110868110-110868132 ATTTTTGAAAAAAAAATATGAGG - Intergenic
960098689 3:113714577-113714599 ATTGATCAAAACAAAAACTGGGG - Intergenic
960454067 3:117848708-117848730 ACTGTTGAAAACATTGACTGGGG - Intergenic
960646913 3:119895821-119895843 AGTTTTGAAAACAAGAAGTGTGG + Intronic
962280014 3:134044344-134044366 AAAATTGAAAACAATAACTGTGG - Intronic
962492922 3:135911112-135911134 GATCTTTAAAACAAAAACTGTGG - Intergenic
962911823 3:139859284-139859306 ATTGATGATAACAAAGTCTGGGG - Intergenic
963517476 3:146326495-146326517 GGTGTTCAAGACAAAAACTGTGG + Intergenic
963533446 3:146498785-146498807 ATTTATAAATACAAAAACTGAGG - Intergenic
964133801 3:153320679-153320701 ATTTTTGAAAACAAAAATAAAGG - Intergenic
964222320 3:154361595-154361617 ATTTTTGAAAACAAAAGCTTTGG - Intronic
964332551 3:155619918-155619940 ATTTTTGAAAAGTAAACCTGAGG - Intronic
965123347 3:164592353-164592375 AATGTTGAAAGCAAAAATTATGG - Intergenic
965239581 3:166177562-166177584 ATTGTTAAAAAAAAAAGGTGTGG + Intergenic
965421362 3:168463152-168463174 AAGGCTGAAACCAAAAACTGAGG - Intergenic
965788105 3:172357731-172357753 AAAATTGAAAAAAAAAACTGAGG - Intronic
966071987 3:175890021-175890043 ATTTTTAATAATAAAAACTGGGG + Intergenic
966130940 3:176638383-176638405 ATTTTATAAAACAGAAACTGAGG + Intergenic
966244002 3:177785799-177785821 GTGGTTGAAAAAAAAAAATGAGG - Intergenic
966578472 3:181531016-181531038 TTTGTTGAAAAGAAAATTTGGGG - Intergenic
967273751 3:187752899-187752921 ATTGTTGAGTTCTAAAACTGGGG + Intergenic
967359311 3:188611488-188611510 ATTGTTGAAAACAAAAACTGTGG - Intronic
967660135 3:192097269-192097291 GTTGATGAAAACAAACAATGGGG + Intergenic
967798780 3:193630412-193630434 ATTATTGAAATAAAAAATTGGGG + Intronic
968346973 3:198016750-198016772 ATTCTTAAAAACTAAAACTGTGG + Intronic
969921300 4:10542818-10542840 ATGGATGAAAAAAAAAACTAAGG + Intronic
970469595 4:16363669-16363691 AAAGTTGAAAACTAAAACTAAGG + Intergenic
970541350 4:17083055-17083077 ATTGTTGAAAAGAAAAGGTCAGG - Intergenic
970676002 4:18451240-18451262 ATCTTTGAGAACAGAAACTGTGG - Intergenic
971682456 4:29717987-29718009 ATTGTTCTAAACAATAAATGTGG + Intergenic
971747782 4:30606678-30606700 ATTTTTTAAAAAAAAAATTGGGG - Intergenic
971786495 4:31110275-31110297 TTTGCTGAAAATAAAAACTGTGG - Intronic
972022903 4:34337154-34337176 ATTGATGAAAACATACACTAGGG - Intergenic
972078226 4:35114546-35114568 AATCTTGAAAACAAATAATGGGG + Intergenic
972658578 4:41091256-41091278 AGTCTTGCAAACAAAAATTGTGG - Intronic
975014106 4:69390583-69390605 ATTTTTTAAAAAGAAAACTGAGG - Intronic
975056757 4:69943040-69943062 ATTTCAGAAAAAAAAAACTGAGG - Intronic
975528083 4:75373272-75373294 ATTGTTGAAAAAAAAATCTGGGG + Intergenic
975534790 4:75437752-75437774 ATTCTTGTAAACTAAAAGTGAGG + Intergenic
976122424 4:81797989-81798011 ATTCTTGAAAAAAAAAGCAGAGG + Intronic
977040941 4:92017430-92017452 ATTATTTAAAAAAAAAACCGTGG + Intergenic
977321935 4:95527885-95527907 AATGTTGAAAACAAAAATGTGGG - Intronic
978225455 4:106328851-106328873 ATCGTTGAAAACCTGAACTGAGG - Intronic
978232734 4:106420325-106420347 AATTTTGAACACAAAAATTGGGG + Intergenic
978305850 4:107328018-107328040 AGTGTTGGGAAAAAAAACTGAGG + Intergenic
978631103 4:110745849-110745871 ATTCCTGAAAATAAAAACAGAGG - Intergenic
978640581 4:110866646-110866668 ATTCTTTAAAACAAATGCTGTGG - Intergenic
979135070 4:117101087-117101109 ATAGGTGAAAAGACAAACTGTGG + Intergenic
980353186 4:131709270-131709292 ACTTTTGAAAACAAAAACAAGGG - Intergenic
980608080 4:135119912-135119934 AAAGTTAAAAACAAAAACTTTGG - Intergenic
980657310 4:135806491-135806513 ATTGTAGGAAAGAAAAACTCAGG - Intergenic
980754125 4:137135480-137135502 ATAGAGGAAAACAAATACTGAGG + Intergenic
980800651 4:137745129-137745151 AATGTTGGAAAAAAAAACAGAGG + Intergenic
981049502 4:140296346-140296368 AGTTCTGAAAACATAAACTGTGG - Intronic
981078287 4:140613118-140613140 ATAGTTTAAAAGAATAACTGAGG + Intergenic
981925814 4:150138306-150138328 ATTGTTGAAAACAGAATAAGAGG + Intronic
982154048 4:152497642-152497664 AATGTTGATAAAAAAAAGTGTGG + Intronic
982766247 4:159352292-159352314 ACTGTTGAAAACAAGATCAGTGG + Intronic
983180673 4:164644685-164644707 ATTGTTGAAAACTTACCCTGTGG - Intergenic
983372114 4:166873544-166873566 ATTGTTGTGAACATAAACTGCGG + Intronic
983689578 4:170451974-170451996 ATAGATGCAAACAAAAAATGCGG - Intergenic
983996974 4:174194027-174194049 ACTTTTGAAAACAATAATTGAGG - Intergenic
984316103 4:178134469-178134491 CTCCTTTAAAACAAAAACTGTGG - Intergenic
984321634 4:178204652-178204674 ATTCTAGAAAAGACAAACTGTGG + Intergenic
984375554 4:178924297-178924319 ATTTTTGAAGACAAAAACAAAGG - Intergenic
984659197 4:182355104-182355126 ATTGTTGCCAACAGAGACTGGGG + Intronic
985198424 4:187458787-187458809 ATTGTTAAAAAAAAATCCTGGGG - Intergenic
985468233 5:18579-18601 ATTGTTGGAAACCCAAACTCTGG + Intergenic
987368850 5:17174870-17174892 ATTTTTTATAACAAAAACTAGGG + Intronic
987595615 5:19994438-19994460 ATTGTTTATATCAAAAACTTGGG - Intronic
987595730 5:19996383-19996405 ATTGTTTATATCAAAAACTTGGG - Intronic
988015207 5:25547861-25547883 ATTTTTGAAATCAGGAACTGTGG + Intergenic
988048656 5:25994134-25994156 ATTGATGAAAACATAACTTGGGG - Intergenic
988143903 5:27279089-27279111 AGTATTGAAAACAGAAACTTAGG - Intergenic
988305808 5:29493139-29493161 ATTGTTAAAAACAAGCAGTGAGG - Intergenic
989221400 5:38969270-38969292 TTTGTTAAAAACAAAAACACAGG - Intronic
990050872 5:51498397-51498419 GTGATTGAATACAAAAACTGTGG - Intergenic
990221717 5:53598536-53598558 TTTTTTGAAAACATAAAATGAGG - Intronic
990583320 5:57185696-57185718 CCTGTTTAAAAAAAAAACTGGGG + Intronic
990928896 5:61063623-61063645 ATTGATGCATACAAAAACTCTGG - Intronic
991238916 5:64433698-64433720 ATTTTTAAAATAAAAAACTGTGG - Intergenic
991494854 5:67216798-67216820 ATTGTTAAGAACAAAACCTAAGG + Intergenic
991920020 5:71647452-71647474 ATTATTAAAAACAAGAACTCTGG - Intronic
992027624 5:72686156-72686178 ATTGTTGAAACCACAGTCTGTGG + Intergenic
992092466 5:73329809-73329831 AATCTTGAAAATAAAAAATGTGG - Intergenic
992121750 5:73600502-73600524 ATCGTTGAATAAATAAACTGTGG - Intergenic
992284772 5:75223472-75223494 CATTTTGGAAACAAAAACTGTGG - Intronic
992521640 5:77557963-77557985 ATTGTTTAGAAGAAAAAATGTGG + Intronic
992851660 5:80816155-80816177 TTTCATGAAATCAAAAACTGTGG - Intronic
992862323 5:80923683-80923705 ATTTTTTAATACAAAAACTGTGG - Intergenic
992931204 5:81647704-81647726 CATTTTGAATACAAAAACTGAGG - Intronic
993055311 5:82973717-82973739 ATCTTTGAAAACAAAAAATGGGG - Intergenic
993975751 5:94477784-94477806 ATTGTAAAAAACAAAAGTTGTGG - Intronic
994089330 5:95795291-95795313 ATTGTAAAAAACAGATACTGTGG + Exonic
994261500 5:97664735-97664757 ATTTTTGAAAGAAAAAATTGTGG + Intergenic
994488739 5:100414021-100414043 ATTGTGGAAAACATAAAATAAGG - Intergenic
994522677 5:100861203-100861225 ATTGTTAAAAGCATAAAATGTGG - Intronic
994541371 5:101102363-101102385 ATTGTTATAATCAAAAACTTTGG - Intergenic
995142107 5:108746745-108746767 ATTGTTAAATGCACAAACTGTGG - Intergenic
995261009 5:110104345-110104367 ATTTTTAAAAAAAAACACTGAGG - Intergenic
996297215 5:121935105-121935127 ATTGTCAAGAAGAAAAACTGAGG - Intergenic
996766752 5:127041928-127041950 ATTTTTAAAAATAAAAGCTGGGG + Intergenic
996778974 5:127162604-127162626 ATTGTTAAAAAAGAAAAGTGTGG - Intergenic
997040157 5:130243466-130243488 ATTTTTGCAAACAAACACTCAGG - Intergenic
997095740 5:130909261-130909283 ATTGTTTACAACAAAATCTATGG - Intergenic
998358690 5:141564998-141565020 ATTCTTAAAAATAAAATCTGTGG - Intronic
1000149613 5:158486663-158486685 ATTTTTCAAAACAAAAATTAAGG + Intergenic
1000807269 5:165811149-165811171 ATTTGTCAAAACAAAAACAGAGG - Intergenic
1001741279 5:174054932-174054954 ATTGTTGTAAAGATAAAATGAGG + Intronic
1001888644 5:175319565-175319587 ATTTTTCCAAACAGAAACTGTGG - Intergenic
1002020324 5:176360454-176360476 ATAGCTTAAAAAAAAAACTGGGG - Intronic
1003150722 6:3546569-3546591 ACTGTTGAAAATAAAATTTGGGG - Intergenic
1003431681 6:6044121-6044143 GTTGTTTAAAAAAAAAAATGAGG - Intergenic
1003732008 6:8835599-8835621 ATTGTTGCAAACAATAAAAGAGG - Intergenic
1004039165 6:11958960-11958982 ATTGCTCAAACCAGAAACTGGGG + Intergenic
1006252588 6:32800761-32800783 ATTTTAGAAAATAAAAAATGTGG - Intergenic
1006728310 6:36215971-36215993 ATTGTTGAAAACAAAATGTCAGG - Intronic
1007355772 6:41315154-41315176 ACTGTTAAAAAGATAAACTGAGG + Intergenic
1007952236 6:45882676-45882698 ATTGATGATAAGAAATACTGTGG + Intergenic
1008200457 6:48581732-48581754 TATGTTGAAAAAAAAAACCGAGG + Intergenic
1008710404 6:54218814-54218836 ATTATTGAAAAAAGAAAATGTGG - Intronic
1008897417 6:56572806-56572828 ATTTTTAGAAACAAAAACTCAGG - Exonic
1009318056 6:62248286-62248308 ATTTTAAAAAAAAAAAACTGGGG + Intronic
1009337873 6:62516056-62516078 ATTGTTAAAAACAAAAACATAGG - Intergenic
1009566328 6:65315601-65315623 ATTATTGAATATAATAACTGTGG + Intronic
1009581621 6:65542433-65542455 ATTTTTCAAAAAAATAACTGTGG + Intronic
1009955862 6:70452338-70452360 ATTGTTGGAAAAAAAAAATCAGG - Intronic
1010012548 6:71066207-71066229 TTTGTTTAAAAAAATAACTGAGG - Intergenic
1010175814 6:73026845-73026867 TTTATAGAAAAAAAAAACTGAGG + Intronic
1010686298 6:78858347-78858369 AGTGTTGGGAAAAAAAACTGAGG + Intergenic
1010730285 6:79383461-79383483 TTTGTTTAAAACAGAAAGTGAGG + Intergenic
1011091613 6:83608695-83608717 TTTGAGGAAAAAAAAAACTGAGG + Intronic
1011206894 6:84908907-84908929 ATTTTTGAAAACAAAAATCAAGG + Intergenic
1011457820 6:87570887-87570909 ATTGTTGCAAAGAAAAATTAAGG - Intronic
1011639307 6:89404250-89404272 ATTGTTGTTAAAACAAACTGAGG + Intronic
1012042901 6:94233442-94233464 ACTGTTGAAAACATAATTTGGGG + Intergenic
1012107952 6:95189854-95189876 ATGGTTGAAAACCAAGACTGTGG + Intergenic
1012637330 6:101560884-101560906 ATTCTTCAAAACATTAACTGTGG - Intronic
1012913010 6:105137747-105137769 CTGTTTGAAAACAAAAACAGTGG - Intergenic
1013432271 6:110065682-110065704 ATTACTGAGAAAAAAAACTGGGG + Intergenic
1013683942 6:112556762-112556784 AAAGTTGAAAACAGAAAATGGGG - Intergenic
1013857672 6:114593645-114593667 ATAGTTGCACACAAAAACTAAGG + Intergenic
1013903152 6:115181590-115181612 AACATTAAAAACAAAAACTGAGG + Intergenic
1014471511 6:121820914-121820936 ATTGCTAAATATAAAAACTGTGG - Intergenic
1015396880 6:132744680-132744702 ATTGTTGAAACTAAAATCTTGGG - Intronic
1015996808 6:139003131-139003153 AATCTTAAAAACTAAAACTGTGG + Intergenic
1017259302 6:152368594-152368616 ATTATTTAGAACAAAAACTCTGG + Intronic
1017622787 6:156316435-156316457 TTTGTTGAAAAGATAAAATGGGG - Intergenic
1017703962 6:157103243-157103265 TTTGTTGAAAAAAAAAAGTATGG - Intronic
1018257597 6:161937501-161937523 TTTGTTGAAGACACAAGCTGTGG - Intronic
1019039206 6:169089561-169089583 CTTGTTGAAAATGAAAAATGTGG - Intergenic
1019616820 7:1967073-1967095 ATGACTGAAAACAAAACCTGTGG + Intronic
1020508568 7:9022863-9022885 ATTGTTGAAAAAAAAATCAAGGG - Intergenic
1020582715 7:10025273-10025295 ATTCTTGAAAATAAATTCTGTGG - Intergenic
1020669241 7:11085885-11085907 ATAGTTTAAAAAAAAAACTGTGG + Intronic
1020690998 7:11354451-11354473 AATTTTGAAAAGAAAAACTAGGG - Intergenic
1020703934 7:11518418-11518440 TTTGTAGAAAAGCAAAACTGGGG + Intronic
1020705972 7:11544717-11544739 ATTTTTCAGAACAAAAACTGTGG - Intronic
1020720078 7:11733098-11733120 ATTGTTGAAAACATGAGATGGGG - Intronic
1020937982 7:14491771-14491793 ATTCTTGAGAACAAAGAATGAGG - Intronic
1021180515 7:17500204-17500226 ACTGTTAGAAACCAAAACTGAGG + Intergenic
1021944139 7:25708875-25708897 ATTGTAAAAAACAAAGACTAAGG + Intergenic
1021983527 7:26077737-26077759 ATTTTTGAAAATAAAATCGGGGG + Intergenic
1022551756 7:31247232-31247254 ATGGGTTAAAAAAAAAACTGTGG - Intergenic
1022893722 7:34727960-34727982 ATGGTTAAAAAAAAAACCTGAGG + Intronic
1022987507 7:35672262-35672284 ATTGTTTAAAAAAAAAAAAGAGG + Intronic
1023348901 7:39299974-39299996 ACTGCTGGAAACAAAAACAGTGG - Intronic
1024087126 7:45902876-45902898 ATTGTTGAAAACAATACAGGAGG + Intergenic
1024226750 7:47331193-47331215 GTTGCTGAAAACAGAACCTGTGG - Intronic
1024493765 7:50018119-50018141 ATTGTTGAAATCCTTAACTGTGG + Intronic
1024808841 7:53183378-53183400 ATTGTTAAAAATAAATTCTGAGG + Intergenic
1024894350 7:54240124-54240146 ATTGATGACTACAAAATCTGAGG - Intergenic
1027207763 7:76115767-76115789 ATTTTAGAAAGCAAATACTGTGG + Intergenic
1027667058 7:81053231-81053253 ATTATTAAAAACACAATCTGTGG + Intergenic
1027939429 7:84655452-84655474 TTTCTTGAAATTAAAAACTGTGG + Intergenic
1028047317 7:86138909-86138931 ATTTTTGAAAAGAAAAATTATGG + Intergenic
1028274889 7:88843076-88843098 ACTGTTAGAAACAAAAGCTGAGG + Intronic
1029304662 7:99610134-99610156 ATGGGTGAAAAAAAAAACTAAGG - Intergenic
1029947452 7:104547830-104547852 TTTGATGTAAACGAAAACTGAGG - Intronic
1030268047 7:107641002-107641024 ATTGCTGAAAACTAAAATGGAGG + Intergenic
1031723368 7:125205829-125205851 GTTATTCAAAACAAAAACTTTGG - Intergenic
1031745044 7:125485223-125485245 ATTCTTGAAAGGAAAAACTATGG + Intergenic
1031747361 7:125518014-125518036 ATTGTTAAAAACATAAAGTAAGG + Intergenic
1032110910 7:129074470-129074492 ATTTTTGAATTCAGAAACTGTGG - Intergenic
1032147314 7:129395740-129395762 AGTGCTCAAAACAAAGACTGGGG - Intronic
1032147651 7:129398680-129398702 TTTGTTTAAAAAAAAAAATGGGG - Intronic
1032232221 7:130084792-130084814 ATTGCTCAAGACAAAAACTTAGG - Intronic
1033033455 7:137847739-137847761 AATCTTAGAAACAAAAACTGGGG - Intergenic
1033046958 7:137971148-137971170 TATGTTTAAAAAAAAAACTGGGG + Intronic
1035576543 8:710582-710604 ACTGTGGAAAAGCAAAACTGAGG - Intronic
1036519635 8:9478915-9478937 ATTGTTGAGCACATAAACTGTGG + Intergenic
1036584404 8:10109930-10109952 TATGTGGAAACCAAAAACTGTGG - Intronic
1036990702 8:13590299-13590321 ATAGCTGCAAAAAAAAACTGGGG - Intergenic
1036992218 8:13611219-13611241 ATATTTGAAAACAAAACTTGAGG + Intergenic
1037081203 8:14788670-14788692 ATTGTTGGTAACAAAAAGAGTGG - Intronic
1037243632 8:16805773-16805795 ATTTTTGAAACAAAAATCTGGGG + Intergenic
1038471383 8:27825784-27825806 ATTGTTGAAAGATAAAGCTGGGG + Intronic
1038814830 8:30891483-30891505 ATTGTCGAAAAAAAAAAGGGGGG - Intergenic
1039011680 8:33100585-33100607 ATTTTTGATATGAAAAACTGAGG + Intergenic
1039367848 8:36950487-36950509 GTTTTTGAAAACAAAAAATAAGG + Intergenic
1039715190 8:40100797-40100819 ATCGTTGTAATCAGAAACTGGGG - Intergenic
1039725139 8:40207260-40207282 CTTGTGAAAAACAAAAACTGAGG + Intergenic
1039940908 8:42090251-42090273 ATAGTTGAACAGATAAACTGTGG + Intergenic
1040622731 8:49107718-49107740 ATTGTAAAAAACAAAACCAGGGG + Intergenic
1040939901 8:52821618-52821640 ATATTTTAAAACAGAAACTGAGG - Intergenic
1040999296 8:53434465-53434487 TTTGTTGTAAACAAAAACACTGG - Intergenic
1041111538 8:54487556-54487578 ATTGTAGAACACCAAAGCTGGGG - Intergenic
1041298358 8:56385821-56385843 ATTTTTCTAAACAAAAACTATGG - Intergenic
1041433823 8:57816333-57816355 ATTGTTGAAAAATAAAATGGAGG + Intergenic
1041475933 8:58266071-58266093 AATGCTGAAAGAAAAAACTGTGG + Intergenic
1042112622 8:65396815-65396837 ATTTTTCAAAACAAAAAATGTGG - Intergenic
1042223894 8:66500152-66500174 ATTGTTTAATAGAAAAAATGGGG - Intronic
1042381686 8:68122659-68122681 ATTGTTCAAAACAAAAAAGTGGG - Intronic
1042382563 8:68134870-68134892 ATATTTGAAAAATAAAACTGTGG + Intronic
1042383684 8:68149329-68149351 ATTGCTGAAGGCAAGAACTGCGG + Intronic
1043801297 8:84613826-84613848 ATTGTTTAAAGTAAAAACTGCGG - Intronic
1044116172 8:88337033-88337055 ATTATAGAAAAAAATAACTGTGG + Intergenic
1044569053 8:93698132-93698154 ATTGTTCAAGTCAAAAACTTAGG - Intergenic
1045558918 8:103241820-103241842 ATTGCTCAAAACAGAAACTCTGG + Intergenic
1045709655 8:104968286-104968308 ATTGCTCAAAACAATAAATGAGG + Intronic
1046761466 8:118025754-118025776 ATTTTTGAAAAAAAAAATTATGG - Intronic
1047298801 8:123595108-123595130 ATTGTTGCAAGAAGAAACTGAGG + Intergenic
1047387251 8:124421478-124421500 ATGGTTAAAAAATAAAACTGGGG - Intergenic
1048481761 8:134802772-134802794 AGTGTTGAAGAAAAAAATTGTGG - Intergenic
1048990585 8:139757985-139758007 GTTGTTTAAAATAAAAAATGAGG - Intronic
1050229347 9:3502346-3502368 ATTTTTGAAATCAATAATTGAGG + Intronic
1050550039 9:6741071-6741093 ATAGTTGAAAACAAAAATTAAGG - Intronic
1050601627 9:7258573-7258595 TTTGCTGGAAACAAAAAGTGAGG + Intergenic
1051404737 9:16724360-16724382 ACTGTTAAAAGCAAAAAATGAGG - Intronic
1051406966 9:16748141-16748163 AGAGTAGAAAAGAAAAACTGAGG + Intronic
1051737120 9:20211722-20211744 ATTTTTGAAAATATAAATTGGGG - Intergenic
1051943463 9:22537011-22537033 GATTTTGAAAGCAAAAACTGAGG - Intergenic
1052156161 9:25193598-25193620 AGTGATGAAAATAAATACTGTGG - Intergenic
1052540019 9:29799042-29799064 GTTGCAGAATACAAAAACTGGGG + Intergenic
1052707617 9:32011603-32011625 ATTTTTGTAAAAAAAATCTGTGG + Intergenic
1053504930 9:38634167-38634189 ATTGGTATAAACAAGAACTGGGG - Intergenic
1053618069 9:39790389-39790411 TTTGTAGAAAACAAAAATTGAGG - Intergenic
1053876245 9:42549756-42549778 TTTGTAGAAAACAAAAATTGAGG - Intergenic
1053896411 9:42744877-42744899 TTTGTAGAAAACAAAAATTGAGG + Intergenic
1054235452 9:62551966-62551988 TTTGTAGAAAACAAAAATTGAGG + Intergenic
1054266088 9:62917040-62917062 TTTGTAGAAAACAAAAATTGAGG + Intergenic
1055108307 9:72535573-72535595 ATTGTGGAACACCAAAACTCAGG - Intronic
1055495210 9:76847461-76847483 AGTATTTAAAAAAAAAACTGAGG + Intronic
1055738012 9:79353794-79353816 ATTGTTGGAATAAAAAACAGTGG + Intergenic
1055833339 9:80408837-80408859 ATTTTCTCAAACAAAAACTGAGG + Intergenic
1056497846 9:87177723-87177745 ATAGATGAAAAGAAAATCTGAGG + Intergenic
1056903304 9:90621648-90621670 ATTTCTGAAAAGAGAAACTGGGG - Intronic
1056991012 9:91411022-91411044 CTTGTTGAAAGAAAGAACTGTGG - Intronic
1057685923 9:97234471-97234493 AGTGTAGAAAAAAAAAAGTGAGG - Intergenic
1057968849 9:99533548-99533570 ATTTTTTTAAAAAAAAACTGAGG + Intergenic
1057999759 9:99852969-99852991 ATAGTTAAAAACAAAAATGGTGG + Intronic
1058245610 9:102621093-102621115 AATTTTGAAAACAAAAATTATGG + Intergenic
1058321302 9:103635154-103635176 ATTGTTGAAAATACATACTGTGG + Intergenic
1058357293 9:104097404-104097426 ATTTTTAAAAACAAAATCTTGGG - Intronic
1058989086 9:110237752-110237774 TTTTTTGTAAATAAAAACTGAGG + Intergenic
1059522739 9:114958764-114958786 CTAGTTGAAAACAAAAACCTAGG - Intergenic
1059851420 9:118345542-118345564 ATTGTTGACAACAAGATCTAAGG + Intergenic
1060136282 9:121158180-121158202 ATTGTAGAAAAGAATAAATGCGG + Intronic
1061030155 9:128076767-128076789 ATGGTTAAAAACAAAAAGTTAGG - Intronic
1203611786 Un_KI270749v1:14157-14179 ATAGATTAAAAAAAAAACTGTGG + Intergenic
1186069806 X:5806859-5806881 ATTTTTAAAAATAAAATCTGTGG + Intergenic
1186879311 X:13849153-13849175 ATTGTTTAAAAAAATAAATGTGG + Intronic
1186917659 X:14240923-14240945 ATTGTTTTAGACAAAAACAGTGG + Intergenic
1187058935 X:15767371-15767393 ATTGTTCAAAAGAAAAAGAGAGG - Intronic
1187159067 X:16747560-16747582 ATTGTAAAGAACCAAAACTGTGG - Intronic
1187714392 X:22088205-22088227 ATTCATGAAAGCATAAACTGTGG - Intronic
1188310078 X:28605582-28605604 ACTGTAGAAAACAATAACAGAGG - Intronic
1188782363 X:34301439-34301461 TTTATTGGAAACAAAATCTGTGG + Intergenic
1188863962 X:35291401-35291423 ATCATTAAAAACAAAATCTGGGG - Intergenic
1189082012 X:37983782-37983804 ATTGTGGAAAGAAAAAACAGTGG - Intronic
1189296031 X:39918478-39918500 ATTCTTGAAAACACAAATGGGGG - Intergenic
1189604904 X:42666672-42666694 ATTGTTTAAACCAAAAACCCAGG + Intergenic
1189661091 X:43300616-43300638 ATTAATGAAAACAAAAAATAAGG - Intergenic
1190020597 X:46870408-46870430 ATTGTTTAAAAAAATAGCTGGGG - Intronic
1190643183 X:52500602-52500624 ATTGTAGAAAACTAAAACTTTGG + Intronic
1190644489 X:52512265-52512287 ATTGTAGAAAACTAAAACTTTGG - Intronic
1190650087 X:52560723-52560745 ATTGTGTAAAACTAAAACTTCGG - Intergenic
1190809778 X:53872051-53872073 ATTGATGAAAACGAAAACTCAGG + Intergenic
1191593508 X:62915815-62915837 ATTATTGAAAACAAATAATGGGG + Intergenic
1192082829 X:68064653-68064675 ATTGTAGACCACAAAAGCTGGGG - Intronic
1192954643 X:76056417-76056439 TTTGGTGAAAACAAGAAATGAGG + Intergenic
1193764070 X:85504416-85504438 ATCTTTCAAAGCAAAAACTGAGG - Intergenic
1194046269 X:89007972-89007994 ATTTTTGATAACAAAAGCTGTGG - Intergenic
1194046272 X:89008226-89008248 ATTTTTGATAACAAAAGCTGTGG - Intergenic
1194785271 X:98076279-98076301 CTTCTTGAAAATAAAAAATGTGG + Intergenic
1195476223 X:105288961-105288983 ATTCTTGAAAAGATAATCTGTGG + Intronic
1196387328 X:115172633-115172655 ATTTTTCAAAAGAAAAAATGGGG - Intronic
1196558627 X:117120934-117120956 ATTGTGGAAAAAAAAAAATGTGG - Intergenic
1197035363 X:121867684-121867706 TGTTTTAAAAACAAAAACTGAGG - Intergenic
1197248508 X:124190762-124190784 ATTTTGGAAAACAAAAATTCAGG + Intronic
1197401572 X:125998331-125998353 ATTGAATAAAACAAAAATTGTGG - Intergenic
1197431449 X:126371323-126371345 ATTGTAGACAACAAAAACAAAGG + Intergenic
1198121552 X:133597567-133597589 ATTGCTGCAAACACAAGCTGGGG + Intronic
1198150930 X:133908546-133908568 ATGGTTGAAAGAAAGAACTGGGG - Intronic
1200753514 Y:6968474-6968496 GCTGTTAGAAACAAAAACTGAGG + Intronic
1200885616 Y:8265881-8265903 ATTGGTGCAAAGAAATACTGTGG + Intergenic
1201793091 Y:17863987-17864009 ATCTTTTAAAACAAGAACTGGGG + Intergenic
1201808463 Y:18041999-18042021 ATCTTTTAAAACAAGAACTGGGG - Intergenic
1201976911 Y:19861100-19861122 ACTTTTCCAAACAAAAACTGAGG - Intergenic
1202354624 Y:24033231-24033253 ATCTTTTAAAACAAGAACTGGGG + Intergenic
1202516154 Y:25636881-25636903 ATCTTTTAAAACAAGAACTGGGG - Intergenic