ID: 967359312

View in Genome Browser
Species Human (GRCh38)
Location 3:188611507-188611529
Sequence CAATTGCAACAGATTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967359311_967359312 -4 Left 967359311 3:188611488-188611510 CCACAGTTTTTGTTTTCAACAAT 0: 1
1: 0
2: 8
3: 46
4: 580
Right 967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG 0: 1
1: 0
2: 1
3: 10
4: 109
967359310_967359312 27 Left 967359310 3:188611457-188611479 CCAGTTCAGAGAAACAGATTATT 0: 1
1: 0
2: 1
3: 23
4: 249
Right 967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG 0: 1
1: 0
2: 1
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967359312 Original CRISPR CAATTGCAACAGATTTACCC AGG Intronic
906132084 1:43466441-43466463 CAATTAGGTCAGATTTACCCAGG - Intergenic
906949785 1:50324966-50324988 ATATTGCAACAGATTGACCATGG + Intergenic
912077735 1:105897871-105897893 CAAATACAACAAAATTACCCAGG + Intergenic
913586876 1:120283917-120283939 CTATTGCATCAAATTTACCTTGG + Intergenic
913621310 1:120614453-120614475 CTATTGCATCAAATTTACCTTGG - Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914568891 1:148895802-148895824 CTATTGCATCAAATTTACCTTGG + Intronic
914603936 1:149234454-149234476 CTATTGCATCAAATTTACCTTGG - Intergenic
918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG + Intergenic
919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG + Intergenic
920884467 1:209913117-209913139 GAAGTGCAAGAGATTTACCGAGG - Intergenic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
1066320796 10:34301772-34301794 GAATTGCCACAGTTTTAGCCTGG - Intronic
1067260929 10:44690830-44690852 CAGTTGCAGCAGTTTTACCAGGG - Intergenic
1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG + Intergenic
1074006173 10:109426787-109426809 CAATTGAAGCAGATTTGGCCAGG + Intergenic
1078498693 11:11846829-11846851 CAATTGCAGCACATTTCCTCAGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1081341346 11:41931810-41931832 AAATTGCAAAAGATTCACTCAGG + Intergenic
1086230509 11:84564123-84564145 CACTTGCAATAGGCTTACCCTGG - Intronic
1086527936 11:87750960-87750982 CAATTGCATCCCATTTACCCAGG + Intergenic
1086664116 11:89458210-89458232 CATTTGCAAAAGATTTAATCTGG + Intronic
1087167166 11:95016505-95016527 CAAGTGCAACAGACCTACCATGG + Intergenic
1091541416 12:1465944-1465966 CAGTGGCAACAGAATTAGCCTGG - Intronic
1091562899 12:1628499-1628521 CAATAACTACAGATTTCCCCAGG - Intronic
1091864589 12:3820496-3820518 CAATGGGAACAGTTTTACTCTGG - Intronic
1100114989 12:91293932-91293954 CATTTTCAACTGATGTACCCAGG + Intergenic
1100472768 12:94908475-94908497 GAATTGCCATAGATTGACCCAGG - Intronic
1102895529 12:116595405-116595427 GAATTGCAACATATTTGGCCAGG - Intergenic
1107199097 13:37691981-37692003 CTATAGTAACACATTTACCCAGG + Exonic
1107610372 13:42107083-42107105 AAATTGCAATAGATTCACACAGG - Intronic
1110043611 13:70799132-70799154 CCTTTGCAACAGAATTACCAAGG + Intergenic
1115197533 14:30817463-30817485 CAATCGCAACAGCCTTCCCCTGG + Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1120052863 14:79888405-79888427 CAATTACATCAGAATCACCCAGG - Intergenic
1120192827 14:81454722-81454744 CAAGTGAAACAGCTTTACGCTGG + Intergenic
1121213049 14:92223643-92223665 AAAATGCAAGAGTTTTACCCAGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG + Intergenic
1131855698 15:96591250-96591272 CCATTGCAACAAATTTACTGAGG - Intergenic
1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG + Intronic
1141329579 16:83097488-83097510 TAATTGCAGCAGAGTTACCAAGG + Intronic
1142949691 17:3468060-3468082 TTATTTCAACAGATTTAGCCTGG + Intronic
1144578360 17:16443890-16443912 CAATGGCAACCGGTTGACCCGGG - Exonic
1144907874 17:18651415-18651437 AAAATGGAACAGATTTATCCGGG + Intronic
1155698363 18:28711788-28711810 CCATAGCAACAAATTTACCATGG - Intergenic
1158664763 18:59422511-59422533 CAATTGCAACAAGTTTCCTCAGG + Intergenic
1159054314 18:63449657-63449679 CAATTTCAACAGAATCACCAGGG - Intergenic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
928068229 2:28188325-28188347 CATTTGAAACTGATTTACTCTGG + Intronic
930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG + Intronic
940018645 2:149133449-149133471 GAAGTGAAACAGATTTACTCTGG - Intronic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
942404540 2:175640229-175640251 CAACTGCATCATAATTACCCAGG + Intergenic
945008911 2:205440990-205441012 CAATTGTAAAAGATTTATTCAGG + Intronic
945197404 2:207250207-207250229 CACTTGCAACAAAATTACACGGG + Intergenic
1169768866 20:9179598-9179620 CGAATACAGCAGATTTACCCAGG + Intronic
1175468660 20:59210218-59210240 CAATTAAAACAGAATTGCCCCGG + Intronic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
1178209321 21:30510374-30510396 CCATTGCCACAGCTATACCCTGG + Intergenic
1179416805 21:41204611-41204633 AAATTGCAACATATTAACCTTGG - Intronic
1181998702 22:26903201-26903223 AAATTGCATCAACTTTACCCAGG + Intergenic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
949867274 3:8556635-8556657 CAATTGCAACGGCTTTGCCCGGG - Intronic
949901424 3:8817970-8817992 CAAATGCAACACATTTAGTCAGG - Intronic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
953661221 3:44893359-44893381 AAATTGCTCCAGATTTTCCCAGG + Intronic
961588939 3:127960373-127960395 CAAATGCAAAATATATACCCTGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
963452874 3:145507043-145507065 CAATTGCAATACATTTTTCCTGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970289222 4:14553295-14553317 CAATTACCACAGAAATACCCAGG + Intergenic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
973626713 4:52779821-52779843 AATATGCAACAGAATTACCCTGG + Intergenic
975201900 4:71600758-71600780 AAATTGTAACACATTTCCCCAGG - Intergenic
975477085 4:74835665-74835687 CAATTGAAACAGATTCACAGAGG + Intergenic
978828022 4:113048038-113048060 CAATAGCAACACATTTACATAGG + Intronic
981290008 4:143063601-143063623 CAATTGCATCAGATTATCCAAGG - Intergenic
982480758 4:155907113-155907135 CAATTGCCACAAAGTTCCCCCGG + Intronic
982948521 4:161658910-161658932 CAATTGCTACTAAGTTACCCTGG + Intronic
988545243 5:32150367-32150389 AAATAGCAACAGATTTTCCCTGG + Intronic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989635614 5:43529797-43529819 AAAATGGAACAGATTTATCCGGG - Exonic
990766304 5:59187432-59187454 CAATAGAAACAGATTAACCTGGG + Intronic
993078406 5:83265283-83265305 CAATTGCTATATATTTACTCTGG + Intronic
994144893 5:96383826-96383848 CTATTGCAACAGAGTGCCCCTGG - Intergenic
995445471 5:112237893-112237915 AAATTGGAACAGATTTAGCATGG + Intronic
997981461 5:138470143-138470165 CAATGGGAACAGATTTGGCCCGG - Intergenic
998507097 5:142680858-142680880 CAAAGGCAACAGAATTACCTAGG + Intronic
999864013 5:155680581-155680603 CAATTGCAGTAGATTTATCCAGG + Intergenic
1004636446 6:17472613-17472635 CAATGGCAAGAGAATTACCTTGG + Intronic
1010207780 6:73338323-73338345 CATTTTCAACAGATTTACTGAGG - Intergenic
1010233118 6:73553069-73553091 CAAATACATCAGAATTACCCAGG + Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1017216865 6:151918296-151918318 CACTTGCATGAGATTTAACCAGG - Intronic
1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG + Intergenic
1022607367 7:31828718-31828740 CAATGGCCACAGGTTGACCCAGG - Intronic
1027681381 7:81225847-81225869 CAAAAGCAACAGATTTACAGTGG - Intergenic
1036453428 8:8889405-8889427 CAATTACAAAAGATTTTCTCTGG + Intronic
1038291769 8:26256162-26256184 AAATTCAAACAGATTGACCCAGG - Intergenic
1046974737 8:120261854-120261876 CAATTGCAAAAGACATTCCCAGG - Intronic
1048938759 8:139378461-139378483 CAATTTCAACAGATTTTCAAAGG - Intergenic
1048960884 8:139575808-139575830 CAATAGCAACAAGTGTACCCAGG - Intergenic
1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG + Intergenic
1051650279 9:19316663-19316685 CAATTGAAGCAGATTTCTCCTGG + Exonic
1058164815 9:101607387-101607409 CTATAGCAACAGACTTACACAGG + Intronic
1059223110 9:112644528-112644550 CAATTTGAACAGATTAAGCCTGG + Intronic
1186250510 X:7660762-7660784 CAATTGCATCAAATATACCAGGG + Intergenic
1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG + Intergenic
1187854706 X:23625584-23625606 AAATTGAAACAGTTTTCCCCTGG - Intergenic
1190622106 X:52297717-52297739 CAATTGGAACACATGGACCCAGG + Intergenic
1190923240 X:54877387-54877409 CAATTGCAACTCATTTTCCTTGG + Intergenic
1194966737 X:100296898-100296920 CAATTTCATCAGCTTTTCCCAGG + Intronic
1197610522 X:128633300-128633322 CAATTGCTACAGAATCACCCAGG + Intergenic
1198807027 X:140503388-140503410 CAAATGTAACAGAATAACCCTGG + Exonic
1199395047 X:147326468-147326490 TAATTGTAACTGTTTTACCCAGG + Intergenic
1202360030 Y:24097937-24097959 AAATTCCAACAGATACACCCAGG - Intergenic
1202510747 Y:25572177-25572199 AAATTCCAACAGATACACCCAGG + Intergenic