ID: 967361907

View in Genome Browser
Species Human (GRCh38)
Location 3:188640674-188640696
Sequence GGCAATGAGACTCTTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967361907_967361909 -3 Left 967361907 3:188640674-188640696 CCCATAGCAAGAGTCTCATTGCC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 967361909 3:188640694-188640716 GCCTTACCATATAGCTCTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967361907 Original CRISPR GGCAATGAGACTCTTGCTAT GGG (reversed) Intronic
908486368 1:64598024-64598046 GGCAAGGTGACTCTTCCTCTGGG + Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918798639 1:188940694-188940716 GGAAGTGTGACTCTTGCTATGGG + Intergenic
919493578 1:198236405-198236427 GGAAAGAAGACTCTTGCTATAGG + Intronic
921255190 1:213332551-213332573 ACTAATGAGACTCTTCCTATAGG - Intergenic
922644393 1:227271819-227271841 TGTAATGAGATTGTTGCTATGGG - Intronic
924158732 1:241208272-241208294 GGCCATGAGACTCATGGTTTGGG - Intronic
1065669828 10:28103871-28103893 GGAAAGGAGACTCCTGCTTTGGG + Intronic
1068113321 10:52707202-52707224 AGCACTGAGAGTCTTACTATAGG - Intergenic
1070417041 10:76200598-76200620 AGCAATAAGACTATTGCTACTGG - Intronic
1078130961 11:8613791-8613813 GGCAAGGAAGCTCTTGCTTTAGG + Exonic
1081257799 11:40918757-40918779 GAAAATGAGACCCATGCTATAGG - Intronic
1089263652 11:117241279-117241301 GGCAGTGAGCTTCTTGCTTTAGG + Intronic
1090120942 11:124027502-124027524 CGGATTGAGACTCTTGCTTTAGG + Intergenic
1093441811 12:19207392-19207414 GGCAAAGACACCCTTGCCATTGG - Intronic
1097973277 12:65657905-65657927 GGCAATCAGACTCTTAATGTTGG + Intergenic
1099499371 12:83393115-83393137 AGCAATGAGACAGTTGCTTTGGG + Intergenic
1103204013 12:119114150-119114172 GGTAATGAGGCACTGGCTATAGG + Intronic
1104228894 12:126864597-126864619 GGCAAGGACACTCTTCCTCTTGG - Intergenic
1114450177 14:22820166-22820188 GGCACTGACACTCTTGAGATGGG - Intronic
1127405202 15:58637017-58637039 TGCAATAGGACACTTGCTATTGG - Intronic
1127862753 15:63007944-63007966 GGAGATGAACCTCTTGCTATTGG - Intergenic
1129056724 15:72825769-72825791 GCCAATGAGACTATAGCTAAGGG - Intergenic
1131808470 15:96147820-96147842 GGCAATGAGAGTGATGCTACTGG - Intergenic
1134200824 16:12197242-12197264 GGCAATGAGGCTCTGGCTAAAGG + Intronic
1138557865 16:57783343-57783365 GGCAATGAGACACTGGTGATGGG + Intronic
1140844180 16:78870979-78871001 GTCTATGAGACCCTGGCTATTGG - Intronic
1149099434 17:52885988-52886010 GGAAATGAGGCTCTTGTCATCGG - Intronic
1163637635 19:18444788-18444810 GGCGATGAGCCTCTTGATGTGGG + Exonic
1164445710 19:28316078-28316100 GGCCATGAGTCTTTTGCTTTGGG - Intergenic
926610304 2:14940218-14940240 GGCAAGGAGTTTCTTTCTATTGG - Intergenic
930024307 2:47021026-47021048 GGCATTCAGTCTCTTGCTGTGGG + Intronic
932173101 2:69575331-69575353 GGGAATGAGGCACTTGCTAGGGG + Intronic
933194328 2:79371469-79371491 GAGAATGAGTCTCTTGCTGTTGG - Intronic
935895386 2:107731816-107731838 AGCAATGAGACTCCTCCAATAGG + Intergenic
938450434 2:131413981-131414003 GGCCATCAGACTCTGGCTTTAGG - Intergenic
939203521 2:139069936-139069958 GGCACTGAGAGACTGGCTATTGG + Intergenic
941084525 2:161101512-161101534 GGCAGTGAGAATCTTGGAATGGG - Intergenic
943881953 2:193157150-193157172 GGAAATGAGAATCATGTTATTGG - Intergenic
947806823 2:232974725-232974747 GGCAATGAGGCTCTTTGTCTTGG + Exonic
1169813597 20:9633557-9633579 GGTAATGATACTCTTGATTTTGG + Intronic
1171050138 20:21850241-21850263 GCCAATGGGACTCCTGCTCTGGG + Intergenic
1173568146 20:44056327-44056349 GGCACTGTGGCTTTTGCTATAGG + Intronic
1177874883 21:26619811-26619833 GGCGATGAAACTCTTGAGATGGG - Intergenic
1180883287 22:19221809-19221831 AGCAATGAGTTACTTGCTATTGG - Intronic
1184986778 22:48141243-48141265 GGCTATGAGACCCTTTCTAAGGG - Intergenic
949740878 3:7232344-7232366 GGGAATGAGACTGTTGTCATGGG + Intronic
954180739 3:48879635-48879657 GCCACTGAGACCCTTGCTCTGGG - Intronic
955147157 3:56331269-56331291 TCCAATGAGATTCTTGCTAAAGG - Intronic
955562689 3:60209550-60209572 GGGAATGAGATTTTTACTATTGG - Intronic
956172276 3:66442488-66442510 TGGAATGAGACTGTTGATATGGG + Intronic
959181537 3:102986473-102986495 GGTAATGAGATTCTTACTAATGG - Intergenic
964035201 3:152187379-152187401 GGTAATGGGATTCATGCTATTGG + Intergenic
967361907 3:188640674-188640696 GGCAATGAGACTCTTGCTATGGG - Intronic
970306601 4:14739004-14739026 GGCAATGAGACTCATCATTTTGG - Intergenic
971793013 4:31193300-31193322 AGCATAGAGAATCTTGCTATAGG + Intergenic
981447317 4:144854940-144854962 GGCCATGAGACTCTGGCTGGTGG - Intergenic
981609471 4:146578015-146578037 GGCAATGTGCCTCCTGCTGTTGG + Intergenic
982342886 4:154322382-154322404 GGCAATGACACTCATTCTGTAGG + Exonic
995367437 5:111378912-111378934 GGCCAGGAGACTCTTGCTTGAGG - Intronic
999923198 5:156345273-156345295 TTCAATGAAACTTTTGCTATTGG + Intronic
1001154543 5:169261842-169261864 GGCAATGCCCGTCTTGCTATAGG + Intronic
1016851434 6:148623280-148623302 GTCTATGAGACTCTTCCTGTTGG - Intergenic
1018290978 6:162292433-162292455 GGCAATGAGCCTCTGCCTGTAGG - Intronic
1018306619 6:162463630-162463652 GACAATGTGACTACTGCTATGGG + Intronic
1023696824 7:42856490-42856512 GGCACTGACACTCTGGATATTGG + Intergenic
1024842706 7:53604864-53604886 AGCACTGAGACTCTTTCTTTAGG - Intergenic
1026228259 7:68461558-68461580 GGCAATGAGAATCATGCTTTAGG + Intergenic
1026249074 7:68651530-68651552 GGCAATAAGACTCTTAATAAGGG - Intergenic
1028639388 7:93026207-93026229 TTCAGTGAGCCTCTTGCTATAGG - Intergenic
1029104485 7:98164273-98164295 GGCAATGAGACTTTTGATTAAGG + Intronic
1029342545 7:99956755-99956777 GGCAATGAGACTCTTTGGGTTGG - Intergenic
1030061007 7:105621269-105621291 GGAAATGAGAGTCTTGATAAGGG - Intronic
1030647129 7:112074368-112074390 GGCTATGAGCCCCTTGATATAGG - Intronic
1031142350 7:117957095-117957117 GTCAATGTGAGTCTTGCTAACGG - Intergenic
1032092801 7:128920016-128920038 GGAAATGAGACTCCTGGTAAAGG + Intergenic
1037897816 8:22669874-22669896 GGCAATTATAATCATGCTATAGG + Intergenic
1040786320 8:51168534-51168556 GGCACTGAGGCACTTGCTAGTGG - Intergenic
1044448401 8:92304934-92304956 GTCAATGTATCTCTTGCTATCGG + Intergenic
1052587794 9:30451284-30451306 GGCAATGAAACTTTTACAATGGG - Intergenic
1056219644 9:84438332-84438354 GGCAATGTGACTTTTGCCAATGG + Intergenic
1056316060 9:85391261-85391283 GGCGATGAGACTCAAGCTTTTGG - Intergenic
1060906553 9:127312257-127312279 GGCAAAGACACTCATGATATGGG + Intronic
1187213263 X:17250352-17250374 GGCAATTAGACACTTGCTCCTGG + Intergenic
1192004411 X:67194424-67194446 TTAAATGAGAATCTTGCTATGGG - Intergenic
1195162645 X:102185566-102185588 TGCAATGAGACTCTTTTTCTTGG + Intergenic
1195166704 X:102227175-102227197 TGCAATGAGACTCTTTCTCTTGG + Intergenic
1195192156 X:102459913-102459935 TGCAATGAGACTCTTTCTCTTGG - Intronic
1199229969 X:145425195-145425217 GTCAATGAGAGTGTTGCCATAGG - Intergenic
1201275964 Y:12299182-12299204 GGCAATTACACGCTTGCTATGGG - Intergenic
1201696022 Y:16827263-16827285 GGCACTGAGACCATTGCTCTGGG - Intergenic